In the following instances, you will need to calculate the concentration of primers or probes in solution:

  • You have synthesized your own primers or probes for the first time, but are unsure how to work out their concentration.
  • You did not reconstitute or recover all the lyophilized (freeze-dried) powder from a tube containing a primer or probe, so you are unsure of your stock concentration.
  • You have a primer stock solution of a previously-known concentration, which is unlabeled or incorrectly labeled, so you do not know its concentration.

Alternatively, you may be struggling to calculate the amount of liquid needed to reconstitute a known mass of lyophilized primer or probe, in order to achieve the desired concentration for your working stocks.

If any of these problems sound relevant to you, the following simple examples provide tips on how to overcome them.

First, there are a few basic concepts to bear in mind. These will clarify the relationships between units, and should help you convert one unit to the other.

  • A 1 molar (M) solution contains 1 mole of solute in 1 liter of solution.
  • A 1 micromolar (µM) solution contains 1 µmol of solute in 1 liter of solution. This is equivalent to 0.000001 (1 x 10^-6) moles per liter.
  • A 1 picomolar (pM) solution contains 1 pmol of solute in 1 liter of solution. This is equivalent to 0.000000000001 (1 x 10^-12) moles per liter.

Let’s start with an example of a researcher who synthesized primers for the first time. They intended to use the primers to detect vascular endothelial growth factor (VEGF) expression in human fibroblasts. The researcher obtained an unknown quantity of the synthesized primers in a buffer and needed to calculate the concentration of the primers in this solution so they could use it correctly. A simple formula can accomplish this task, but first we need to obtain some further information.

For this example, the forward strand of the primer (5’ to 3’ orientation) reads CAAGACAAGAAAATCCCTGTGG. The first step in this process is to spectrophotometrically analyze the primer to determine its absorbance at 260 nm (known as A260). So as not to waste the precious primer, the researcher diluted it 1:100 in 1X TE buffer to achieve a final volume of 1 mL (10 µL primer solution and 990 µL of 1X TE—this is a dilution factor of 100). The researcher then determined the A260 of the diluted sample, which was 0.135, and took note of the path length of the cuvette used in the spectrophotometer, which was 0.4 cm. To summarize, the researcher has the following pieces of information: the A260 of their analyzed primer sample (0.135), its dilution factor (100), and the path length of the cuvette used (0.4 cm).

However, the researcher needed to obtain one more piece of the puzzle before they could apply the formula. They had to calculate the sum of the extinction coefficient contributions of the nucleobases in the primer strand. This might sound complicated, but it isn’t: essentially, each nucleobase (adenine, cytosine, guanine and thymine) in the strand is assigned a value and we just need to add them up.

Here are the values that must be applied to each of the four nucleobases. These values are known as the chromophore extinction coefficients, and if you use this method you will need to apply them to your primer sequence.

Nucleotide

Chromophore extinction coefficient

A

15,200

C

7,050

G

12,010

T

8,400

So, for the primer strand in this example (CAAGACAAGAAAATCCCTGTGG), there are:

9 As: (15,200 x 9)

5 Cs: (7,050 x 5)

5 Gs: (12,010 x 5)

3 Ts: (8,400 x 3)

Let’s add that up.

(15,200 x 9) + (7,050 x 5) + (12,010 x 5) + (8,400 x 3)

136,800 + 35,250 + 60,050 + 25,200 = 257,300

Sum of the extinction coefficient contributions = 257,300 M^-1cm^-1

Once the researcher had obtained this information, the researcher was then able to apply the following formula to work out the primer concentration in moles/liter [1].

Concentration in moles/liter (C) = (dilution factor × A260) ÷ (sum of extinction coefficient contributions × cuvette path length)

For our example, that would be:

C = (100 x 0.135) ÷ (257,300 x 0.4)

C = 13.5 ÷ 102,920

C = 0.000131 M

This moles/liter figure is a little cumbersome, so we can convert it to µM units by multiplying the value by 10^6 to get a final concentration.

C = 131 µM

What if we want to calculate the concentration of oligonucleotide probes with fluorescent dye labels? The procedure is nearly identical, with one key difference: we need to account for the chromophore extinction coefficients of the dyes in the probe before applying the same formula.

Here are some chromophore extinction coefficients for commonly used dyes.

Dye

Chromophore extinction coefficient

FAM

20,958

TAMRA

31,980

TET

16,255

JOE

12,000

VIC

30,100

For simplicity, let’s use the oligonucleotide strand in the example above (CAAGACAAGAAAATCCCTGTGG), but this time assume that the researcher has synthesized it as a probe and FAM dye is attached to the 5’ end, while TAMRA dye is attached to the 3’ end.

In this scenario, the formula is the same as the one we used in the first primer example, and we do the calculation in the same way. Now, though, we must add the extinction coefficients of the two dyes when calculating the sum.

So, for the probe in this example (TET dye – CAAGACAAGAAAATCCCTGTGG – JOE dye), there are:

9 As: (15,200 x 9)

5 Cs: (7,050 x 5)

5 Gs: (12,010 x 5)

3 Ts: (8,400 x 3)

1 FAM dye: (20,958 x 1)

1 TAMRA dye: (31,980 x 1)

Let’s add that up.

(15,200 x 9) + (7,050 x 5) + (12,010 x 5) + (8,400 x 3) + (20,958 x 1) + (31,980 x 1)

136,800 + 35,250 + 60,050 + 25,200 + 20,958 + 31,980 = 310,238 M-1cm-1

The researcher can then use this sum of extinction coefficient contributions in the formula, exactly as described above, and all other aspects of the calculation remain the same.

C = (100 x 0.135) ÷ (310,238 x 0.4)

C = 13.5 ÷ 124,095

C = 0.000109 M (109 µM)

If you purchase a primer or probe, it typically arrives in a tube as lyophilized powder, with a mass in picomoles (pmol—see list of units above), and needs reconstituting in a buffer prior to use. If you are struggling to calculate the required amount of liquid with which to reconstitute a known mass of lyophilized primer or probe to a desired concentration, the following example will provide clarity.

First, identify the concentration required for your working stock. For primers, this typically ranges from 10–100 µM, and for probes, from 2–10 µM. Let’s run through an example to calculate the buffer volume required for reconstituting primers at a desired concentration.

A researcher purchases lyophilized primer for EFNB2, a gene involved in blood vessel growth. They intend to measure EFNB2 expression in human myocardial cells using qPCR, to see if a growth factor treatment will induce the cells to grow blood vessels through a biomaterial scaffold. Before the researcher can use the primer, it must be reconstituted and aliquoted.

The researcher requires a primer concentration of 60µM in their final working stock. The primer was supplied as a 120,000 picomole (pmol; 1 pmol = 10^-12 mole) mass of lyophilized powder at the bottom of a plastic tube. Let’s work through the calculations needed to reconstitute the powder at a final concentration of 60µM in the solution.

Given that the final concentration is expressed in units of µM, the first step is to express the mass of the powder in µmol. There are 10^6 pmols in 1 µmol, so if we divide the number of pmols in our powdered primer by 10^6 we will obtain the number of µmols.

120,000 pmol ÷ 10^6 = 0.120 µmol

Once the researcher knew the mass of the primer in µmol, the researcher was able to use the following simple formula [2] to calculate the volume of liquid in liters needed to reconstitute it for a final concentration of 60µM.

Volume in liters = mass of solute ÷ desired concentration

In this case: Volume in liters = 0.120 µmol ÷ 60 µM

Volume in liters = 0.002 L

We can convert this volume to a more convenient unit, mL, by multiplying by 1000 (since there are 1000 mL in 1 L).

0.002 x 1000 = 2 mL

If the researcher reconstitutes the EFNB2 primer in 2 mL of liquid (such as 1X TE buffer), they will achieve a final concentration of 60 µM. The solution can then be aliquoted and stored until needed.

As we have illustrated, the calculations for determining primer concentrations, dilutions are not difficult, and if you work through the examples provided here, you should be able to prepare and use oligonucleotide working stocks with confidence and precision.

References

1.  TaqMan Fast Virus 1-Step Master Mix manual (see page 26}
2.  Reconstituting and Diluting Primers and TaqMan Probes application note