T7 RNA Polymerase (20 U/µL)

Catalog number: EP0111

Thermo Scientific™  Related applications: In Vitro Transcription | Protein Expression

Error loading your content!

  Catalog number
Select a plan
Unit size
Price ({{currency}}) Your price ({{currency}}) Availability Qty
{{product.sku}} {{product.sku}}
also known as {{product.formattedSku}} 
{{subscriptionDetails.selectedRatePlan.billingPeriod}} {{subscriptionDetails.selectedRatePlan.billingPeriod}} {{product.availability.message}}
Pro add-ons

Your on-site stock

›› {{supplyCenter.scName}}({{scProduct.stockOnHand}} In stock)
›› {{supplyCenter.scName}}(Out of stock)
›› {{supplyCenter.scName}}
This item is not currently available on-site. Depending on your Supply Center settings you may be able to add the item to cart above else use the Order Non-Stocked Items' tab on the Supply Center home page.
Back to top

Description

Thermo Scientific Bacteriophage T7 RNA polymerase is a DNA-dependent RNA polymerase with strict specificity for its respective double-stranded promoters. It catalyzes the 5'→3' synthesis of RNA on either single-stranded DNA or double-stranded DNA downstream from it promoter.

Highlights

• Incorporates modified nucleotides (e.g., aminoallyl-, biotin-, fluorescein-, digoxigenin-labeled nucleotides)

Applications

Synthesis of unlabeled and labeled RNA that can be used:

• For hybridization, in vitro RNA translation
• As aRNA, siRNA, substrate in RNase protection assays, template for genomic DNA sequencing
• In studies of RNA secondary structure and RNA-protein interactions, RNA splicing

Consensus promoter sequence:
T7: TAATACGACTCACTATAGGGAGA
For Research Use Only. Not for use in diagnostic procedures.

Specifications

Polymerase: T7 RNA Polymerase
Product Size: 5,000 units

Documents

Manuals & protocols

Recommended products