How stable are your cationic lipids that are used in transfection?

Product FAQ

Answer

All the following lipids are stable at 4º C for at least one year:
11668-019 Lipofectamine™ 2000
10362-100 Cellfectin™ II
10459-014 DMRIE-C
10964-013 Lipofectamine™ PLUS™
18292-011 Lipofectin™
18324-012 Lipofectamine™

Answer Id: E3211

Was this answer helpful?

Yes
No
Thank you for your response

Can PCR primers be tailed directly with attL sites for direct recombination into the destination vector?

Product FAQ

Answer

No, this is not really feasible due to the fact that the attL sequence is approximately 100 bp, which is too long for efficient oligo synthesis. Our own maximum sequence length for ordering custom primers is 100 nucleotides. In contrast, the attB sequences are only 25 bp long, which is a very reasonable length for adding onto the 5' end of gene-specific PCR primers.

Answer Id: E3212

Was this answer helpful?

Yes
No
Thank you for your response

What size targets can be amplified by the SuperScript™ One-Step RT-PCR Systems?

Product FAQ

Answer

The SuperScript™ III One-Step RT-PCR System with Platinum™ Taq DNA Polymerase is recommended for amplifying RNA targets up to 4.5 kb and the SuperScript™ II One-Step RT-PCR System with Platinum™ Taq DNA Polymerase is recommended for amplifying RNA targets up to 3.5 kb. Even though the SuperScript™ II and III One-Step RT-PCR Systems with Platinum™ Taq High Fidelity can amplify smaller targets, it is recommended for amplifying RNA targets from 1 kb up to 9 kb.

Answer Id: E3213

Was this answer helpful?

Yes
No
Thank you for your response

How does adding Platinum™ Taq DNA Polymerase improve SuperScript™ One-Step RT-PCR performance?

Product FAQ

Answer

Platinum™ Taq DNA Polymerase is precomplexed with a mixture of antibodies that inhibit polymerase activity until the initial denaturation step in PCR. As a result, nonspecific polymerase acitivty at lower temperatures during set-up and reverse transcription is eliminated, which provides greater yield and specificity of intended product.

Answer Id: E3214

Was this answer helpful?

Yes
No
Thank you for your response

What is the smallest quantity of RNA detectable by the SuperScript™ First-Strand System for RT-PCR?

Product FAQ

Answer

Detection limits dependend on many factors, including primer design, target size, and the abundance of message. In our hands, this system was able to detect GAPDH mRNA from as little as 1.0 pg of total HeLa RNA when used in conjunction with Platinum™ Taq DNA Polymerase High Fidelity.

Answer Id: E3215

Was this answer helpful?

Yes
No
Thank you for your response

Do you have recommended sequencing primers for pDONR™201?

Product FAQ

Answer

We do not offer pre-made primers, but we can recommend the following sequences that can be orders as custom primers for sequencing of pDONR™201:
Forward primer, proximal to attL1: 5'- TCGCGTTAACGCTAGCATGGATCTC
Reverse primer, proximal to attL2: 5'-GTAACATCAGAGATTTTGAGACAC

Answer Id: E3236

Was this answer helpful?

Yes
No
Thank you for your response

Do I have to synthesize new attB primers (29 base attB primer + my specific sequence primer) each time I want to make an attB PCR product, or do you have truncated attB primers that work together with adapter attB primers to get a complete attB sequence?

Product FAQ

Answer

We do have an alternative method called the "attB Adapter PCR" Protocol in which you make your gene specific primer with only 12 additional attB bases and use attB universal adapter primers. This protocol allows for shorter primers to amplify attB-PCR products by utilizing four primers instead of the usual two in a PCR reaction. You can find the sequence of these primers in the protocol on page 45 of the "Gateway™ Technology with Clonase II" manual.

There is a protocol in which all 4 primers mentioned above are in a single PCR reaction. You can find this protocol at in the following article: Quest vol. 1, Issue 2, 2004. The best ratio of the first gene-specific and the second attB primers was 1:10.

Answer Id: E3237

Was this answer helpful?

Yes
No
Thank you for your response

How can I store my viral stock?

Product FAQ

Answer

If the medium is serum-free, add serum to 10%. Serum proteins act as substrates for proteases and therefore prevent degradation of viral coat proteins. Store viral stocks at 4 degrees C, and protect from light. Aliquots can be stored at -80 degrees C, but viral titer should be checked before use, as freeze/thaw cycles of the virus can result in a 10- to 100-fold decrease in viral titer.

Answer Id: E9402

Was this answer helpful?

Yes
No
Thank you for your response

How would you incorporate a leader sequence for secretion into an entry vector?

Product FAQ

Answer

A simple way to express a protein with a leader sequence is to have the leader sequence encoded in the destination vector. The other option is to have the leader sequence subcloned into the entry vector using restriction enzymes, or incorporate the leader sequence into the forward PCR primer when cloning a PCR product into the entry vector. Please see Esposito et al. (2005), Prot. Exp. & Purif. 40, 424-428 for an example of how a partial leader sequence for secretion was incorporated into an entry vector.

Answer Id: E3203

Was this answer helpful?

Yes
No
Thank you for your response

Can a P3 viral stock be used to generate more viruses? How about a P4 or P5 stock?

Product FAQ

Answer

Yes, the same protocol used to make your P2 viral stock can be used to make a P3, P4, or P5 viral stock. We don’t recommend making the stock higher than P5, as more defective interfering particles will be produced and a decrease in protein expression level will occur.

Answer Id: E9434

Was this answer helpful?

Yes
No
Thank you for your response

Can I scale-up the production of recombinant protein using the baculovirus expression system? If so, what methods are available?

Product FAQ

Answer

Yes, large-scale expression experiments can be performed. Please see below for different large-scale methods, requirements, added benefits, and references:
- Stirred bioreactor
- Airlift fermentor
- Insect larvae

Answer Id: E9403

Was this answer helpful?

Yes
No
Thank you for your response

After addition of the agarose overlay to my cells, they look like crescents or are granular. What happened?

Product FAQ

Answer

The agarose overlay was too hot. After addition of the agarose overlay, cells should still be round and healthy.

Answer Id: E9469

Was this answer helpful?

Yes
No
Thank you for your response

How clean must my DNA be to use in a Gateway™ cloning reaction?

Product FAQ

Answer

Mini-prep (alkaline lysis) DNA preparations work well in Gateway™ cloning reactions. It is important that the procedure remove contaminating RNA for accurate quantification. Plasmid DNA purified with our S.N.A.P.™ nucleic acid purification kits, ChargeSwitch™ kits, or PureLink™ kits are recommended.

Answer Id: E3204

Was this answer helpful?

Yes
No
Thank you for your response

After infecting T25 or T75 flasks with virus, when do you begin to see cell lysis and what percentage of cells will be lysed at certain time points?

Product FAQ

Answer

This is dependent on how much virus is added. If cells are infected at an MOI of 5, usually cells are infected at 24 hours, and cells begin to lyse at around 65 hours. If less virus is used, this takes longer, and more virus takes less time.

Answer Id: E9429

Was this answer helpful?

Yes
No
Thank you for your response

Can an old low-titer stock be used to make a high-titer stock?

Product FAQ

Answer

If this lower-titer stock is a P1 or P2 stock, a viral amplification protocol can be used. If the low-titer stock was once a high-titer stock, but has dropped titer due to age or the stock was propagated many generations, then it may be necessary to regenerate the high-titer stock. If the high titer stock is >P5, then there may be an excessive amount of defective interfering particles that infect cells but do not properly replicate or produce protein. If the existing stock is plated out and a fresh plaque is re-isolated (DIPs do not form plaques), a new high-titer stock can be established.

Answer Id: E9435

Was this answer helpful?

Yes
No
Thank you for your response