How large can PCR fragments be and still be cloned into a Gateway™ Entry vector?

Product FAQ

Answer

There is no size restriction on the PCR fragments if they are cloned into a pDONR vector. The upper limit for efficient cloning into a TOPO™ adapted Gateway™ Entry vector is approximately 5 kb. A Gateway™ recombination reaction can occur between DNA fragments that are as large as 150 kb.

Answer Id: E3224

Was this answer helpful?

Yes
No
Thank you for your response

What is the smallest fragment that can be used in a Gateway™ reaction?

Product FAQ

Answer

The smallest size we have recombined is a 70 bp piece of DNA located between the att sites. Very small pieces are difficult to clone since they negatively influence the topology of the recombination reaction.

Answer Id: E3198

Was this answer helpful?

Yes
No
Thank you for your response

Will increasing the Gateway™ cloning reaction time improve recombination efficiency?

Product FAQ

Answer

Yes, increasing the incubation time from 1 hour to 4 hours will generally increase colony numbers 2-3 fold. An overnight incubation at room temperature will typically increase colony yield by 5-10 fold.

Answer Id: E3206

Was this answer helpful?

Yes
No
Thank you for your response

Where can I get Gateway™ vector sequences and maps?

Product FAQ

Answer

Vector information can be found in the product manuals or directly on our web site by entering the catalog number of the product in the search box. The vector map, cloning site diagram, and sequence information will be linked to the product page.

Answer Id: E3210

Was this answer helpful?

Yes
No
Thank you for your response

How does adding Platinum™ Taq DNA Polymerase improve SuperScript™ One-Step RT-PCR performance?

Product FAQ

Answer

Platinum™ Taq DNA Polymerase is precomplexed with a mixture of antibodies that inhibit polymerase activity until the initial denaturation step in PCR. As a result, nonspecific polymerase acitivty at lower temperatures during set-up and reverse transcription is eliminated, which provides greater yield and specificity of intended product.

Answer Id: E3214

Was this answer helpful?

Yes
No
Thank you for your response

Must PCR conditions be changed once the original PCR primers have attB sequence added to them?

Product FAQ

Answer

Since the attB sequences are on the 5' end of oligos, they will not anneal to the target template in the first round of PCR. Sometimes the PCR product is more specific with the attB primers, probably due to the longer annealing sequence (all of attB plus gene specific sequence) after the first round of amplification. Generally there is no need to change PCR reaction conditions when primers have the additional attB sequence

Answer Id: E3222

Was this answer helpful?

Yes
No
Thank you for your response

How clean must my DNA be to use in a Gateway™ cloning reaction?

Product FAQ

Answer

Mini-prep (alkaline lysis) DNA preparations work well in Gateway™ cloning reactions. It is important that the procedure remove contaminating RNA for accurate quantification. Plasmid DNA purified with our S.N.A.P.™ nucleic acid purification kits, ChargeSwitch™ kits, or PureLink™ kits are recommended.

Answer Id: E3204

Was this answer helpful?

Yes
No
Thank you for your response

What do attL1 and attL2 sites look like after recombination between attB and attP sites?

Product FAQ

Answer

The attP1 sequence (pDONR™) is:
AATAATGATT TTATTTTGAC TGATAGTGAC CTGTTCGTTG CAACAAATTG ATGAGCAATGCTTTTTTAT AATGCCAACT TTGTACAAAA AAGC[TGAACG AGAAACGTAA AATGATATAA ATATCAATAT ATTAAATTAG ATTTTGCATA AAAAACAGACTA CATAATACTG TAAAACACAA CATATCCAGT CACTATGAAT CAACTACTTA GATGGTATTA GTGACCTGTA]

The region within brackets is where the site is "cut" and replaced by the attB1-fragment sequence to make an attL1 site. The sequence GTACAAA is the overlap sequence present in all att1 sites and is always "cut" right before the first G.

The overlap sequence in attP2 sites is CTTGTAC and cut before C. This is attP2:
ACAGGTCACT AATACCATCT AAGTAGTTGA TTCATAGTGA CTGGATATGT TGTGTTTTAC AGTATTATGT AGTCTGTTTT TTATGCAAAA TCTAATTTAA TATATTGATA TTTATATCAT TTTACGTTTC TCGTTCAGCT TTCTTGTACA AAGTTGGCAT TATAAGAAAG CATTGCTTAT AATTTGTTG CAACGAACAG GTCACTATCA GTCAAAATAA AATCATTATT

So, attL1 (Entry Clone) should be:
A ATAATGATTT TATTTTGACT GATAGTGACC TGTTCGTTGC AACAAATTGA TGAGCAATGC TTTTTTATAA TGCCAACT TT G TAC AAA AAA GC[A GGC T]NN NNN

attL2 (Entry Clone) should be:
NNN N[AC C]CA GCT TT CTTGTACA AAGTTGGCAT TATAAGAAAG CATTGCTTAT CAATTTGTTG CAACGAACAG GTCACTATCA GTCAAAATAA AATCATTATT

The sequence in brackets comes from attB, and N is your gene-specific sequence.

Note: When creating an Entry Clone through the BP reaction and a PCR product, the vector backbone is not the same as Gateway™ Entry vectors. The backbone in the case of PCR BP cloning is pDONR™201.

Answer Id: E3225

Was this answer helpful?

Yes
No
Thank you for your response

Do you have a recommended single-step protocol for BP/LR recombination?

Product FAQ

Answer

Yes, we have come up with a single-step protocol for BP/LR Clonase™ reaction (http://www.thermofisher.com/us/en/home/life-science/cloning/gateway-cloning.html#1), where DNA fragments can be cloned into Destination vectors in a single step reaction, allowing you to save time and money.

Answer Id: E9857

Was this answer helpful?

Yes
No
Thank you for your response

Do you have recommended sequencing primers for pDONR™201?

Product FAQ

Answer

We do not offer pre-made primers, but we can recommend the following sequences that can be orders as custom primers for sequencing of pDONR™201:
Forward primer, proximal to attL1: 5'- TCGCGTTAACGCTAGCATGGATCTC
Reverse primer, proximal to attL2: 5'-GTAACATCAGAGATTTTGAGACAC

Answer Id: E3236

Was this answer helpful?

Yes
No
Thank you for your response

Can the attB primers anneal in a non-specific manner?

Product FAQ

Answer

No, attB primers are highly specific under standard PCR conditions. We have amplified from RNA (RT-PCR), cDNA libraries, genomic DNA, and plasmid templates without any specificity problems.

Answer Id: E3199

Was this answer helpful?

Yes
No
Thank you for your response

What are the prerequisites for Gateway™ cloning and expression?

Product FAQ

Answer

The gene of interest must be flanked by the appropriate att sites, either attL (100 bp) in an Entry clone or attB (25 bp) in a PCR product. For Entry clones, everything between the attL sites will be shuttled into the Gateway™ destination vector containing attR sites, and a PCR product flanked by attB sites must be shuttled into an attP-containing donor vector such as pDONR™221.

The location of translation initiation sites, stop codons, or fusion tags for expression must be considered in your initial cloning design. For example, if your destination vector contains an N-terminal tag but does not have a C-terminal tag, the vector should already contain the appropriate translation start site but the stop codon should be included in your insert.

Answer Id: E3207

Was this answer helpful?

Yes
No
Thank you for your response

How stable are your cationic lipids that are used in transfection?

Product FAQ

Answer

All the following lipids are stable at 4º C for at least one year:
11668-019 Lipofectamine™ 2000
10362-100 Cellfectin™ II
10459-014 DMRIE-C
10964-013 Lipofectamine™ PLUS™
18292-011 Lipofectin™
18324-012 Lipofectamine™

Answer Id: E3211

Was this answer helpful?

Yes
No
Thank you for your response

Are the Gateway™ attB1 and attB2 sites the same as the attB site used for recombination into E. coli by bacteriophage lambda?

Product FAQ

Answer

The Gateway™ attB sites are derived from the bacteriophage lambda site-specific recombination, but are modified to remove stop codons and reduce secondary structure. The core regions have also been modified for specificity (i.e., attB1 will recombine with attP1 but not with attP2).

Answer Id: E3201

Was this answer helpful?

Yes
No
Thank you for your response

Do you offer Gateway™ vectors for expression in plants?

Product FAQ

Answer

We do not offer any Gateway™ vectors for expression in plants.

Answer Id: E9854

Was this answer helpful?

Yes
No
Thank you for your response