What is the size of the CAT protein when expressed in bacteria?

Product FAQ

Answer

Excluding any amino acids resulting from fusion tags, CAT has an apparent molecular weight of 28-32 kD on SDS-PAGE gels.

Answer Id: E3242

Was this answer helpful?

Yes
No
Thank you for your response

Must PCR conditions be changed once the original PCR primers have attB sequence added to them?

Product FAQ

Answer

Since the attB sequences are on the 5' end of oligos, they will not anneal to the target template in the first round of PCR. Sometimes the PCR product is more specific with the attB primers, probably due to the longer annealing sequence (all of attB plus gene specific sequence) after the first round of amplification. Generally there is no need to change PCR reaction conditions when primers have the additional attB sequence

Answer Id: E3222

Was this answer helpful?

Yes
No
Thank you for your response

Do you have a recommended single-step protocol for BP/LR recombination?

Product FAQ

Answer

Yes, we have come up with a single-step protocol for BP/LR Clonase™ reaction (http://www.thermofisher.com/us/en/home/life-science/cloning/gateway-cloning.html#1), where DNA fragments can be cloned into Destination vectors in a single step reaction, allowing you to save time and money.

Answer Id: E9857

Was this answer helpful?

Yes
No
Thank you for your response

Do you have recommended sequencing primers for pDONR™201?

Product FAQ

Answer

We do not offer pre-made primers, but we can recommend the following sequences that can be orders as custom primers for sequencing of pDONR™201:
Forward primer, proximal to attL1: 5'- TCGCGTTAACGCTAGCATGGATCTC
Reverse primer, proximal to attL2: 5'-GTAACATCAGAGATTTTGAGACAC

Answer Id: E3236

Was this answer helpful?

Yes
No
Thank you for your response

What is the purpose of the Proteinase K step following a Gateway™ LR Recombination reaction, and is it critical to the results?

Product FAQ

Answer

When the LR reaction is complete, the reaction is stopped with Proteinase K and transformed into E. coli resulting in an expression clone containing a gene of interest. A typical LR reaction followed by Proteinase K treatment yields about 35,000 to 150,000 colonies per 20ul reaction. Without the Proteinase K treatment, up to a 10 fold reduction in the number of colonies can be observed. Despite this reduction, there are often still enough colonies containing the gene of interest to proceed with your experiment, so the Proteinase K step can be left out after the LR reaction is complete if necessary.

Answer Id: E4230

Was this answer helpful?

Yes
No
Thank you for your response

What is the influence of the attB sequence on protein function, solubility, folding, and expression?

Product FAQ

Answer

Destination vectors that contain N-terminal fusion partners will express proteins that contain amino acids contributed from the attB1 site, which is 25 bases long. This means that in addition to any tag (6x His and/or antibody epitope tag) the N-terminus of an expressed protein will contain an additional 9 amino acids from the AttB1 sequence - the typical amino acid sequence is Thr-Ser-Leu-Tyr-Lys-Lys-Ala-Gly-nnn, where nnn will depend on the codon sequence of the insert.

Effects on protein function: A researcher (Simpson et al. EMBO Reports 11(31):287-292, 2000) demonstrated that GFP fusions (N- terminal and C-terminal) localized to the proper intracellular compartment. The expression constructs were generated using Gateway™ cloning, so the recombinant protein contained the attB1 or attB2 amino acid sequence. The localization function of the cloned recombinant proteins was preserved.

Effects on expression: We have seen no effect of the attB sites on expression levels in E. coli, insect and mammalian cells. The gus gene was cloned into bacterial expression vectors (for native and N-terminal fusion protein expression) using standard cloning techniques and expressed in bacteria. Gus was also cloned into Gateway™ Destination vectors (for native and N-terminal fusion expression) and expressed. When protein expression is compared, there was no difference in the amount of protein produced. This demonstrates that for this particular case the attB sites do not interfere with transcription or translation.

Effects on solubility: A researcher at the NCI has shown that Maltose Binding Protein fusions constructed with Gateway™ Cloning were soluble. The fusion proteins expressed had the attB amino acid sequence between the Maltose Binding Protein and the cloned protein. It is possible that some proteins containing the attB sequence could remain insoluble when expressed in E.coli.

Effects on folding: Two Hybrids screens show the same interacters identified with and without the attB sequence. Presumably correct protein folding would be required for protein-protein interactions to take place. It is possible that some proteins containing the attB sequence may not fold correctly.

Answer Id: E3223

Was this answer helpful?

Yes
No
Thank you for your response

Can I perform the single-step protocol for the BP/LR Clonase™ reaction using BP Clonase™ enzyme and LR Clonase™ enzyme instead of BP Clonase™ II enzyme and LR Clonase™ II enzyme?

Product FAQ

Answer

In the single-step protocol for the BP/LR Clonase™ reaction, we would not recommend substituting the BP Clonase™ II/LR Clonase™ II enzymes with BP Clonase™ /LR Clonase™ enzymes as this would result in very low recombination efficiency.

Answer Id: E9858

Was this answer helpful?

Yes
No
Thank you for your response

Do I have to synthesize new attB primers (29 base attB primer + my specific sequence primer) each time I want to make an attB PCR product, or do you have truncated attB primers that work together with adapter attB primers to get a complete attB sequence?

Product FAQ

Answer

We do have an alternative method called the "attB Adapter PCR" Protocol in which you make your gene specific primer with only 12 additional attB bases and use attB universal adapter primers. This protocol allows for shorter primers to amplify attB-PCR products by utilizing four primers instead of the usual two in a PCR reaction. You can find the sequence of these primers in the protocol on page 45 of the "Gateway™ Technology with Clonase II" manual.

There is a protocol in which all 4 primers mentioned above are in a single PCR reaction. You can find this protocol at in the following article: Quest vol. 1, Issue 2, 2004. The best ratio of the first gene-specific and the second attB primers was 1:10.

Answer Id: E3237

Was this answer helpful?

Yes
No
Thank you for your response

Can I purchase the 5X LR Clonase™ buffer or 5X BP Clonase™ buffer separately?

Product FAQ

Answer

We do not offer the 5X LR Clonase™ buffer and 5X BP Clonase™ buffer as standalone products. They are available as part of the enzyme kits.

Answer Id: E9855

Was this answer helpful?

Yes
No
Thank you for your response

How large can PCR fragments be and still be cloned into a Gateway™ Entry vector?

Product FAQ

Answer

There is no size restriction on the PCR fragments if they are cloned into a pDONR vector. The upper limit for efficient cloning into a TOPO™ adapted Gateway™ Entry vector is approximately 5 kb. A Gateway™ recombination reaction can occur between DNA fragments that are as large as 150 kb.

Answer Id: E3224

Was this answer helpful?

Yes
No
Thank you for your response

Where is the transcriptional start site of the T7 promoter featured in many of Invitrogen™'s vectors?

Product FAQ

Answer

Although Invitrogen™ has not formally mapped the transcriptional start site of the T7 promoter, the following reference indicates that the start site occurs at the G following the CACTATA sequence found in the promoter: Nucleic Acids Research, Vol.20, No. 20, pp 4626-4634.

Answer Id: E4435

Was this answer helpful?

Yes
No
Thank you for your response

What is the difference between LR Clonase™ II and LR Clonase™ II Plus?

Product FAQ

Answer

LR Clonase™ II Plus contains an optimized formulation of recombination enzymes for use in MultiSite Gateway™ LR reactions™. LR Clonase™ and LR Clonase™ II enzyme mixes are not recommended for MultiSite Gateway™ LR recombination reactions, but LR Clonase™ II Plus is compatible with both multi-site and single-site LR recombination reactions.

Answer Id: E5237

Was this answer helpful?

Yes
No
Thank you for your response

What size targets can be amplified by the SuperScript™ One-Step RT-PCR Systems?

Product FAQ

Answer

The SuperScript™ III One-Step RT-PCR System with Platinum™ Taq DNA Polymerase is recommended for amplifying RNA targets up to 4.5 kb and the SuperScript™ II One-Step RT-PCR System with Platinum™ Taq DNA Polymerase is recommended for amplifying RNA targets up to 3.5 kb. Even though the SuperScript™ II and III One-Step RT-PCR Systems with Platinum™ Taq High Fidelity can amplify smaller targets, it is recommended for amplifying RNA targets from 1 kb up to 9 kb.

Answer Id: E3213

Was this answer helpful?

Yes
No
Thank you for your response

What is the first step in an experiment with the Gateway™ system?

Product FAQ

Answer

The first step is to create an Entry clone for your gene of interest. We have 3 options to do this: The first is by BP recombination reaction using the PCR Cloning System with Gateway™ Technology. This is recommended for cloning large (>5 kb) PCR products. We also have Gateway™ compatible TOPO™ Cloning vectors such as pCR™8/GW/TOPO™ and pENTR™/D-TOPO™. The final option is to use restriction enzymes to clone into a pENTR™ Dual Selection vector.

Answer Id: E3208

Was this answer helpful?

Yes
No
Thank you for your response

Will the Anti-HisG antibody recognize proteins made in pDEST17 (N-terminal His tag vector)?

Product FAQ

Answer

No, the Anti-HisG antibody detects the N-terminal polyhistidine (6x His) tag followed by glycine: HHHHHHG. The proteins made from the pDEST17 vectors do not have this glycine following the His tag and therefore will not be recognized by this antibody.

Answer Id: E3881

Was this answer helpful?

Yes
No
Thank you for your response