How large can PCR fragments be and still be cloned into a Gateway™ Entry vector?

Product FAQ

Answer

There is no size restriction on the PCR fragments if they are cloned into a pDONR vector. The upper limit for efficient cloning into a TOPO™ adapted Gateway™ Entry vector is approximately 5 kb. A Gateway™ recombination reaction can occur between DNA fragments that are as large as 150 kb.

Answer Id: E3224

Was this answer helpful?

Yes
No
Thank you for your response

I’d like to perform PCR on a plaque, and also make a stock from the same plaque. How do you suggest I do this?

Product FAQ

Answer

Our R&D team will typically pick a plug and add it to a 12-well dish with 0.5 x 10e6 cells/well and 2.5 mL total volume per well. After approximately 3 days, remove 0.75 mL to make DNA for PCR and keep the remaining medium in an Eppendorf tube as your P1 viral stock. As an aside, it is okay to pick a plaque and store it in Grace’s medium.

Answer Id: E9431

Was this answer helpful?

Yes
No
Thank you for your response

What do attL1 and attL2 sites look like after recombination between attB and attP sites?

Product FAQ

Answer

The attP1 sequence (pDONR™) is:
AATAATGATT TTATTTTGAC TGATAGTGAC CTGTTCGTTG CAACAAATTG ATGAGCAATGCTTTTTTAT AATGCCAACT TTGTACAAAA AAGC[TGAACG AGAAACGTAA AATGATATAA ATATCAATAT ATTAAATTAG ATTTTGCATA AAAAACAGACTA CATAATACTG TAAAACACAA CATATCCAGT CACTATGAAT CAACTACTTA GATGGTATTA GTGACCTGTA]

The region within brackets is where the site is "cut" and replaced by the attB1-fragment sequence to make an attL1 site. The sequence GTACAAA is the overlap sequence present in all att1 sites and is always "cut" right before the first G.

The overlap sequence in attP2 sites is CTTGTAC and cut before C. This is attP2:
ACAGGTCACT AATACCATCT AAGTAGTTGA TTCATAGTGA CTGGATATGT TGTGTTTTAC AGTATTATGT AGTCTGTTTT TTATGCAAAA TCTAATTTAA TATATTGATA TTTATATCAT TTTACGTTTC TCGTTCAGCT TTCTTGTACA AAGTTGGCAT TATAAGAAAG CATTGCTTAT AATTTGTTG CAACGAACAG GTCACTATCA GTCAAAATAA AATCATTATT

So, attL1 (Entry Clone) should be:
A ATAATGATTT TATTTTGACT GATAGTGACC TGTTCGTTGC AACAAATTGA TGAGCAATGC TTTTTTATAA TGCCAACT TT G TAC AAA AAA GC[A GGC T]NN NNN

attL2 (Entry Clone) should be:
NNN N[AC C]CA GCT TT CTTGTACA AAGTTGGCAT TATAAGAAAG CATTGCTTAT CAATTTGTTG CAACGAACAG GTCACTATCA GTCAAAATAA AATCATTATT

The sequence in brackets comes from attB, and N is your gene-specific sequence.

Note: When creating an Entry Clone through the BP reaction and a PCR product, the vector backbone is not the same as Gateway™ Entry vectors. The backbone in the case of PCR BP cloning is pDONR™201.

Answer Id: E3225

Was this answer helpful?

Yes
No
Thank you for your response

How many cells need to be infected in a 12-well plate with 1 plaque?

Product FAQ

Answer

Typically, 0.5 x 106 cells per well in 2.5-3 mL is a good starting point. Lysis should begin by day 3. Virus may be harvested and amplified between 3 and 7 days (90% cell death).

Answer Id: E9432

Was this answer helpful?

Yes
No
Thank you for your response

How stable are your cationic lipids that are used in transfection?

Product FAQ

Answer

All the following lipids are stable at 4º C for at least one year:
11668-019 Lipofectamine™ 2000
10362-100 Cellfectin™ II
10459-014 DMRIE-C
10964-013 Lipofectamine™ PLUS™
18292-011 Lipofectin™
18324-012 Lipofectamine™

Answer Id: E3211

Was this answer helpful?

Yes
No
Thank you for your response

Can you outline the main steps of performing a plaque assay, and any suggestions when performing this assay?

Product FAQ

Answer

Please see the method below for an outline of the main steps of performing a plaque assay:

- Plate cells at 80% confluency in a 6-well plate
- Make a serial dilution of the P1 viral stock (1-10-5) and add to cells
- Incubate for an hour at 27 degrees C
- Mix 1% melted agarose into the medium
- Remove the viral supernatant
- Overlay the cells with the medium containing agarose
- Leave the plates for 2-3 hours for agar to completely solidify
- Incubate plates for 10-14 days
- Count plaques

When performing this assay, we suggest:

- Use cells that are in excellent health, of low passage (10-20) in log-phase growth, and high viability (>95%)
- Check viral stock for sterility (free of contamination)
- Use high-quality, low melting point agarose
- The temperature of the medium with agarose is crucial-too hot, cells will die; but if too cold, it will solidify too quickly
- Wait 2-4 hours before removing the plate after overlay so that the agarose can 100% solidify
- Count plaques on a dilution plate where (1/dilution) x # of plaques = pfu/mL
e.g., if you have 50 plaques on the 10-6 plate, then you have 1(10-6) x 50 = 5 x 10e7 pfu/mL

Answer Id: E9424

Was this answer helpful?

Yes
No
Thank you for your response

Do you have recommended sequencing primers for pDONR™201?

Product FAQ

Answer

We do not offer pre-made primers, but we can recommend the following sequences that can be orders as custom primers for sequencing of pDONR™201:
Forward primer, proximal to attL1: 5'- TCGCGTTAACGCTAGCATGGATCTC
Reverse primer, proximal to attL2: 5'-GTAACATCAGAGATTTTGAGACAC

Answer Id: E3236

Was this answer helpful?

Yes
No
Thank you for your response

Can the bacluovirus infect mammalian cells? How about Drosophila cells?

Product FAQ

Answer

Yes, baculovirus can infect mammalian cells, although only at very high titers. Baculovirus works best in liver cells. However, there is no danger of cross-contamination unless the cells are directly infected with the high-titer stocks. Bacuolvirus can infect Drosophila cells; however, it will not replicate in these cells. The promoters used to drive expression of your gene in a typical baculovirus system are both late promoters and require earlier proteins from the baculovirus genome. Thus, they will not work in S2 cells since the early proteins are not made.

Answer Id: E9433

Was this answer helpful?

Yes
No
Thank you for your response

Can PCR primers be tailed directly with attL sites for direct recombination into the destination vector?

Product FAQ

Answer

No, this is not really feasible due to the fact that the attL sequence is approximately 100 bp, which is too long for efficient oligo synthesis. Our own maximum sequence length for ordering custom primers is 100 nucleotides. In contrast, the attB sequences are only 25 bp long, which is a very reasonable length for adding onto the 5' end of gene-specific PCR primers.

Answer Id: E3212

Was this answer helpful?

Yes
No
Thank you for your response

I performed my PCR and see different banding patterns. What do the different PCR sizes mean?

Product FAQ

Answer

The expected PCR size will depend on the pFastBac™ vector that got transposed into the bacmid:

- Bacmid alone: 300 bp
- With pFastBac™ 1: 2300 bp + size of insert
- With pFastBac™ 1-Gus: 4200 bp
- With pFastBac™ HT: 2430 bp + size of insert
- With pFastBac™ HT-CAT: 3075 bp
- With pFastBac™ Dual: 2560 bp + size of insert
- With pFastBac™ Dual-Gus/CAT: 5340 bp
- With pDEST8: 2316 bp + size of insert
- With pDEST10: 2484 bp + size of insert
- With pDEST20: 3031 bp + size of insert

Answer Id: E9414

Was this answer helpful?

Yes
No
Thank you for your response

Where is the ATG relative to the 5' attB site in a Gateway™ expression clone?

Product FAQ

Answer

This depends on whether you are expressing a fusion or a native protein in the Gateway™ destination vector. For an N-terminal fusion protein the ATG will be given by the destination vector and it will be upstream of the attB1 site. For a C-terminal fusion protein or a native protein, the ATG should be provided by your gene of interest, and it will be downstream of the attB1 site.

Answer Id: E3202

Was this answer helpful?

Yes
No
Thank you for your response

What does viral infection look like in early, late, and very late stages?

Product FAQ

Answer

Please see the description below of the different stages of viral infection:

Early
- Increased cell diameter-a 25-50% increase in the diameter of the cells may be observed.
- Increased size of cell nuclei-the nuclei may appear to "fill" the cells.

Late
- Cessation of cell growth-cells appear to stop growing when compared to a cell-only control.
- Granular appearance
- Signs of viral budding-vesicular appearance of cells.
- Viral occlusions-few cells will contain occlusion bodies, which appear as refractive crystals in the nucleus of the insect cell.
- Detachment-cells release from the dish or flask.

Very late
- Cell lysis-a few cells may fill with occluded virus, die, and burst, leaving signs of clearing in the monolayer.

Answer Id: E9400

Was this answer helpful?

Yes
No
Thank you for your response

What has happened when I see blue colonies? How about colonies which are blue in the center and white on the edges?

Product FAQ

Answer

In the case of a blue colony, the E. coli has the bacmid and the plasmid in it, allowing the cells to survive the selection process. However, because the transposition has not occurred, the LacZ gene is not disrupted. For bulls-eye colonies, this indicates that the transposition took place when the colony was growing. Re-streaking for an isolated clone from the white portion of the mixed colony should yield some colonies where transposition occurred.

Answer Id: E9475

Was this answer helpful?

Yes
No
Thank you for your response

I forgot to add Bluo-gal to my plates. Can I add it later?

Product FAQ

Answer

On the day you intend to pick plaques, make a solution of Bluo-gal in DMSO at 20 mg/mL. Add 50 μL per plate and spread with a glass spreader under sterile conditions. Wait 30-60 min, and your plaques should turn blue.

Answer Id: E9471

Was this answer helpful?

Yes
No
Thank you for your response

I’m yielding no plaques from my baculovirus plaque assay. What are the possible causes for this?

Product FAQ

Answer

The kinetics of infection may be slower than expected. Observe plates until the 8-9th day after infection. If no plaques appear, investigate the following:

- If the cells are not healthy, then poor-quality or no plaques can result. Ideally, cells should be in mid-log phase and have a viability of greater than 90%. Cells should double at least once before infection stops growth. Ensure that the correct amount of cells was used at ~70% confluency.
- The viral replication cycle can be inhibited due to poor nutritional and physical conditions of the cell.
- The temperature of the agarose is also crucial. After overlaying the agarose, the plates should be left untouched for 1 hour for the agarose to completely solidify.
- Excessive condensation during incubation at 27 degrees C can inhibit plaque formation-remove paper towels or open the container containing plates as soon as condensation appears.
- The viral titer is too low: Use a higher viral titer. You may need to re-infect your cells and collect a higher titer of your viral stock.

Answer Id: E9465

Was this answer helpful?

Yes
No
Thank you for your response