How does adding Platinum™ Taq DNA Polymerase improve SuperScript™ One-Step RT-PCR performance?

Product FAQ

Answer

Platinum™ Taq DNA Polymerase is precomplexed with a mixture of antibodies that inhibit polymerase activity until the initial denaturation step in PCR. As a result, nonspecific polymerase acitivty at lower temperatures during set-up and reverse transcription is eliminated, which provides greater yield and specificity of intended product.

Answer Id: E3214

Was this answer helpful?

Yes
No
Thank you for your response

How would you incorporate a leader sequence for secretion into an entry vector?

Product FAQ

Answer

A simple way to express a protein with a leader sequence is to have the leader sequence encoded in the destination vector. The other option is to have the leader sequence subcloned into the entry vector using restriction enzymes, or incorporate the leader sequence into the forward PCR primer when cloning a PCR product into the entry vector. Please see Esposito et al. (2005), Prot. Exp. & Purif. 40, 424-428 for an example of how a partial leader sequence for secretion was incorporated into an entry vector.

Answer Id: E3203

Was this answer helpful?

Yes
No
Thank you for your response

What is the smallest quantity of RNA detectable by the SuperScript™ First-Strand System for RT-PCR?

Product FAQ

Answer

Detection limits dependend on many factors, including primer design, target size, and the abundance of message. In our hands, this system was able to detect GAPDH mRNA from as little as 1.0 pg of total HeLa RNA when used in conjunction with Platinum™ Taq DNA Polymerase High Fidelity.

Answer Id: E3215

Was this answer helpful?

Yes
No
Thank you for your response

How clean must my DNA be to use in a Gateway™ cloning reaction?

Product FAQ

Answer

Mini-prep (alkaline lysis) DNA preparations work well in Gateway™ cloning reactions. It is important that the procedure remove contaminating RNA for accurate quantification. Plasmid DNA purified with our S.N.A.P.™ nucleic acid purification kits, ChargeSwitch™ kits, or PureLink™ kits are recommended.

Answer Id: E3204

Was this answer helpful?

Yes
No
Thank you for your response

How stable are your cationic lipids that are used in transfection?

Product FAQ

Answer

All the following lipids are stable at 4º C for at least one year:
11668-019 Lipofectamine™ 2000
10362-100 Cellfectin™ II
10459-014 DMRIE-C
10964-013 Lipofectamine™ PLUS™
18292-011 Lipofectin™
18324-012 Lipofectamine™

Answer Id: E3211

Was this answer helpful?

Yes
No
Thank you for your response

Will Gateway™ att sites affect the expression of my protein?

Product FAQ

Answer

Expression experiments have shown that the extra amino acids contributed by the attB site to a fusion protein will most likely have no effect on protein expression levels or stability. In addition, they do not appear to have any effect on two-hybrid interactions in yeast. However, as is true with the addition of any extra sequences that result from tags, the possible effects will be protein-dependent.

Answer Id: E3200

Was this answer helpful?

Yes
No
Thank you for your response

What is the purpose of the Proteinase K step following a Gateway™ LR Recombination reaction, and is it critical to the results?

Product FAQ

Answer

When the LR reaction is complete, the reaction is stopped with Proteinase K and transformed into E. coli resulting in an expression clone containing a gene of interest. A typical LR reaction followed by Proteinase K treatment yields about 35,000 to 150,000 colonies per 20ul reaction. Without the Proteinase K treatment, up to a 10 fold reduction in the number of colonies can be observed. Despite this reduction, there are often still enough colonies containing the gene of interest to proceed with your experiment, so the Proteinase K step can be left out after the LR reaction is complete if necessary.

Answer Id: E4230

Was this answer helpful?

Yes
No
Thank you for your response

How many times can I thaw BP Clonase™ II and LR Clonase™ II?

Product FAQ

Answer

BP Clonase™ II and LR Clonase™ II can be freeze/thawed at least 10 times without significant loss of activity. However, you may still want to aliquot the enzymes to keep freeze/thaw variability to a minimum.

These enzymes are more stable than the original BP and LR Clonase™ and can be stored at -20°C for 6 months.

Answer Id: E3205

Was this answer helpful?

Yes
No
Thank you for your response

I performed stable selection but my antibiotic-resistant clones do not express my gene of interest. What could have gone wrong?

Product FAQ

Answer

Here are possible causes and solutions:

Detection method may not be appropriate or sensitive enough:
- We recommend optimizing the detection protocol or finding more sensitive methods. If the protein is being detected by Coomassie/silver staining, we recommend doing a western blot for increased sensitivity. The presence of endogenous proteins in the lysate may obscure the protein of interest in a Coomassie/silver stain. If available, we recommend using a positive control for the western blot.
- Insufficient number of clones screened: Screen at least 20 clones.
- Inappropriate antibiotic concentration used for stable selection: Make sure the antibiotic kill curve was performed correctly. Since the potency of a given antibiotic depends upon cell type, serum, medium, and culture technique, the dose must be determined each time a stable selection is performed. Even the stable cell lines we offer may be more or less sensitive to the dose we recommend if the medium or serum is significantly different.
- Expression of gene product (even low level) may not be compatible with growth of the cell line: Use an inducible expression system.
- Negative clones may result from preferential linearization at a vector site critical for expression of the gene of interest: Linearize the vector at a site that is not critical for expression, such as within the bacterial resistance marker.

Answer Id: E9183

Was this answer helpful?

Yes
No
Thank you for your response

Can PCR primers be tailed directly with attL sites for direct recombination into the destination vector?

Product FAQ

Answer

No, this is not really feasible due to the fact that the attL sequence is approximately 100 bp, which is too long for efficient oligo synthesis. Our own maximum sequence length for ordering custom primers is 100 nucleotides. In contrast, the attB sequences are only 25 bp long, which is a very reasonable length for adding onto the 5' end of gene-specific PCR primers.

Answer Id: E3212

Was this answer helpful?

Yes
No
Thank you for your response

Are the Gateway™ attB1 and attB2 sites the same as the attB site used for recombination into E. coli by bacteriophage lambda?

Product FAQ

Answer

The Gateway™ attB sites are derived from the bacteriophage lambda site-specific recombination, but are modified to remove stop codons and reduce secondary structure. The core regions have also been modified for specificity (i.e., attB1 will recombine with attP1 but not with attP2).

Answer Id: E3201

Was this answer helpful?

Yes
No
Thank you for your response

From where does Gateway™ get its lambda nomenclature, and is it consistent with textbook nomenclature for lambda recombination?

Product FAQ

Answer

The Gateway™ nomenclature is consistent with lambda nomenclature, but we use numbers to differentiate between modified versions of the att sites (attB1, attB2, attP1, attP2, and so on). We have introduced mutations in the att sites to provide specificity and directionality to the recombination reaction. For example, attB1 will only recombine with attP1 and not with attP2.

Answer Id: E3209

Was this answer helpful?

Yes
No
Thank you for your response

Do you have recommended sequencing primers for pDONR™201?

Product FAQ

Answer

We do not offer pre-made primers, but we can recommend the following sequences that can be orders as custom primers for sequencing of pDONR™201:
Forward primer, proximal to attL1: 5'- TCGCGTTAACGCTAGCATGGATCTC
Reverse primer, proximal to attL2: 5'-GTAACATCAGAGATTTTGAGACAC

Answer Id: E3236

Was this answer helpful?

Yes
No
Thank you for your response

What is the difference between LR Clonase™ II and LR Clonase™ II Plus?

Product FAQ

Answer

LR Clonase™ II Plus contains an optimized formulation of recombination enzymes for use in MultiSite Gateway™ LR reactions™. LR Clonase™ and LR Clonase™ II enzyme mixes are not recommended for MultiSite Gateway™ LR recombination reactions, but LR Clonase™ II Plus is compatible with both multi-site and single-site LR recombination reactions.

Answer Id: E5237

Was this answer helpful?

Yes
No
Thank you for your response

What is the influence of the attB sequence on protein function, solubility, folding, and expression?

Product FAQ

Answer

Destination vectors that contain N-terminal fusion partners will express proteins that contain amino acids contributed from the attB1 site, which is 25 bases long. This means that in addition to any tag (6x His and/or antibody epitope tag) the N-terminus of an expressed protein will contain an additional 9 amino acids from the AttB1 sequence - the typical amino acid sequence is Thr-Ser-Leu-Tyr-Lys-Lys-Ala-Gly-nnn, where nnn will depend on the codon sequence of the insert.

Effects on protein function: A researcher (Simpson et al. EMBO Reports 11(31):287-292, 2000) demonstrated that GFP fusions (N- terminal and C-terminal) localized to the proper intracellular compartment. The expression constructs were generated using Gateway™ cloning, so the recombinant protein contained the attB1 or attB2 amino acid sequence. The localization function of the cloned recombinant proteins was preserved.

Effects on expression: We have seen no effect of the attB sites on expression levels in E. coli, insect and mammalian cells. The gus gene was cloned into bacterial expression vectors (for native and N-terminal fusion protein expression) using standard cloning techniques and expressed in bacteria. Gus was also cloned into Gateway™ Destination vectors (for native and N-terminal fusion expression) and expressed. When protein expression is compared, there was no difference in the amount of protein produced. This demonstrates that for this particular case the attB sites do not interfere with transcription or translation.

Effects on solubility: A researcher at the NCI has shown that Maltose Binding Protein fusions constructed with Gateway™ Cloning were soluble. The fusion proteins expressed had the attB amino acid sequence between the Maltose Binding Protein and the cloned protein. It is possible that some proteins containing the attB sequence could remain insoluble when expressed in E.coli.

Effects on folding: Two Hybrids screens show the same interacters identified with and without the attB sequence. Presumably correct protein folding would be required for protein-protein interactions to take place. It is possible that some proteins containing the attB sequence may not fold correctly.

Answer Id: E3223

Was this answer helpful?

Yes
No
Thank you for your response