How large can PCR fragments be and still be cloned into a Gateway™ Entry vector?

Product FAQ

Answer

There is no size restriction on the PCR fragments if they are cloned into a pDONR vector. The upper limit for efficient cloning into a TOPO™ adapted Gateway™ Entry vector is approximately 5 kb. A Gateway™ recombination reaction can occur between DNA fragments that are as large as 150 kb.

Answer Id: E3224

Was this answer helpful?

Yes
No
Thank you for your response

What do attL1 and attL2 sites look like after recombination between attB and attP sites?

Product FAQ

Answer

The attP1 sequence (pDONR™) is:
AATAATGATT TTATTTTGAC TGATAGTGAC CTGTTCGTTG CAACAAATTG ATGAGCAATGCTTTTTTAT AATGCCAACT TTGTACAAAA AAGC[TGAACG AGAAACGTAA AATGATATAA ATATCAATAT ATTAAATTAG ATTTTGCATA AAAAACAGACTA CATAATACTG TAAAACACAA CATATCCAGT CACTATGAAT CAACTACTTA GATGGTATTA GTGACCTGTA]

The region within brackets is where the site is "cut" and replaced by the attB1-fragment sequence to make an attL1 site. The sequence GTACAAA is the overlap sequence present in all att1 sites and is always "cut" right before the first G.

The overlap sequence in attP2 sites is CTTGTAC and cut before C. This is attP2:
ACAGGTCACT AATACCATCT AAGTAGTTGA TTCATAGTGA CTGGATATGT TGTGTTTTAC AGTATTATGT AGTCTGTTTT TTATGCAAAA TCTAATTTAA TATATTGATA TTTATATCAT TTTACGTTTC TCGTTCAGCT TTCTTGTACA AAGTTGGCAT TATAAGAAAG CATTGCTTAT AATTTGTTG CAACGAACAG GTCACTATCA GTCAAAATAA AATCATTATT

So, attL1 (Entry Clone) should be:
A ATAATGATTT TATTTTGACT GATAGTGACC TGTTCGTTGC AACAAATTGA TGAGCAATGC TTTTTTATAA TGCCAACT TT G TAC AAA AAA GC[A GGC T]NN NNN

attL2 (Entry Clone) should be:
NNN N[AC C]CA GCT TT CTTGTACA AAGTTGGCAT TATAAGAAAG CATTGCTTAT CAATTTGTTG CAACGAACAG GTCACTATCA GTCAAAATAA AATCATTATT

The sequence in brackets comes from attB, and N is your gene-specific sequence.

Note: When creating an Entry Clone through the BP reaction and a PCR product, the vector backbone is not the same as Gateway™ Entry vectors. The backbone in the case of PCR BP cloning is pDONR™201.

Answer Id: E3225

Was this answer helpful?

Yes
No
Thank you for your response

How stable are your cationic lipids that are used in transfection?

Product FAQ

Answer

All the following lipids are stable at 4º C for at least one year:
11668-019 Lipofectamine™ 2000
10362-100 Cellfectin™ II
10459-014 DMRIE-C
10964-013 Lipofectamine™ PLUS™
18292-011 Lipofectin™
18324-012 Lipofectamine™

Answer Id: E3211

Was this answer helpful?

Yes
No
Thank you for your response

Do you have recommended sequencing primers for pDONR™201?

Product FAQ

Answer

We do not offer pre-made primers, but we can recommend the following sequences that can be orders as custom primers for sequencing of pDONR™201:
Forward primer, proximal to attL1: 5'- TCGCGTTAACGCTAGCATGGATCTC
Reverse primer, proximal to attL2: 5'-GTAACATCAGAGATTTTGAGACAC

Answer Id: E3236

Was this answer helpful?

Yes
No
Thank you for your response

Can PCR primers be tailed directly with attL sites for direct recombination into the destination vector?

Product FAQ

Answer

No, this is not really feasible due to the fact that the attL sequence is approximately 100 bp, which is too long for efficient oligo synthesis. Our own maximum sequence length for ordering custom primers is 100 nucleotides. In contrast, the attB sequences are only 25 bp long, which is a very reasonable length for adding onto the 5' end of gene-specific PCR primers.

Answer Id: E3212

Was this answer helpful?

Yes
No
Thank you for your response

Where is the ATG relative to the 5' attB site in a Gateway™ expression clone?

Product FAQ

Answer

This depends on whether you are expressing a fusion or a native protein in the Gateway™ destination vector. For an N-terminal fusion protein the ATG will be given by the destination vector and it will be upstream of the attB1 site. For a C-terminal fusion protein or a native protein, the ATG should be provided by your gene of interest, and it will be downstream of the attB1 site.

Answer Id: E3202

Was this answer helpful?

Yes
No
Thank you for your response

What is the smallest quantity of RNA detectable by the SuperScript™ First-Strand System for RT-PCR?

Product FAQ

Answer

Detection limits dependend on many factors, including primer design, target size, and the abundance of message. In our hands, this system was able to detect GAPDH mRNA from as little as 1.0 pg of total HeLa RNA when used in conjunction with Platinum™ Taq DNA Polymerase High Fidelity.

Answer Id: E3215

Was this answer helpful?

Yes
No
Thank you for your response

Do I have to synthesize new attB primers (29 base attB primer + my specific sequence primer) each time I want to make an attB PCR product, or do you have truncated attB primers that work together with adapter attB primers to get a complete attB sequence?

Product FAQ

Answer

We do have an alternative method called the "attB Adapter PCR" Protocol in which you make your gene specific primer with only 12 additional attB bases and use attB universal adapter primers. This protocol allows for shorter primers to amplify attB-PCR products by utilizing four primers instead of the usual two in a PCR reaction. You can find the sequence of these primers in the protocol on page 45 of the "Gateway™ Technology with Clonase II" manual.

There is a protocol in which all 4 primers mentioned above are in a single PCR reaction. You can find this protocol at in the following article: Quest vol. 1, Issue 2, 2004. The best ratio of the first gene-specific and the second attB primers was 1:10.

Answer Id: E3237

Was this answer helpful?

Yes
No
Thank you for your response

Must PCR conditions be changed once the original PCR primers have attB sequence added to them?

Product FAQ

Answer

Since the attB sequences are on the 5' end of oligos, they will not anneal to the target template in the first round of PCR. Sometimes the PCR product is more specific with the attB primers, probably due to the longer annealing sequence (all of attB plus gene specific sequence) after the first round of amplification. Generally there is no need to change PCR reaction conditions when primers have the additional attB sequence

Answer Id: E3222

Was this answer helpful?

Yes
No
Thank you for your response

Will Gateway™ att sites affect the expression of my protein?

Product FAQ

Answer

Expression experiments have shown that the extra amino acids contributed by the attB site to a fusion protein will most likely have no effect on protein expression levels or stability. In addition, they do not appear to have any effect on two-hybrid interactions in yeast. However, as is true with the addition of any extra sequences that result from tags, the possible effects will be protein-dependent.

Answer Id: E3200

Was this answer helpful?

Yes
No
Thank you for your response

What size targets can be amplified by the SuperScript™ One-Step RT-PCR Systems?

Product FAQ

Answer

The SuperScript™ III One-Step RT-PCR System with Platinum™ Taq DNA Polymerase is recommended for amplifying RNA targets up to 4.5 kb and the SuperScript™ II One-Step RT-PCR System with Platinum™ Taq DNA Polymerase is recommended for amplifying RNA targets up to 3.5 kb. Even though the SuperScript™ II and III One-Step RT-PCR Systems with Platinum™ Taq High Fidelity can amplify smaller targets, it is recommended for amplifying RNA targets from 1 kb up to 9 kb.

Answer Id: E3213

Was this answer helpful?

Yes
No
Thank you for your response

Which competent E. coli do you recommend using for propagation of my Gateway™-adapted mammalian Destination vector?

Product FAQ

Answer

We recommend using One Shot™ ccdB Survival™ 2 T1R Competent Cells, Cat. No. A10460. This strain is resistant to the toxic effects of the ccdB gene. Note: Do not use general E. coli cloning strains, including TOP10 or DH5alpha™, for propagation and maintenance, as these strains are sensitive to ccdB effects.

Answer Id: E9153

Was this answer helpful?

Yes
No
Thank you for your response

What is the smallest fragment that can be used in a Gateway™ reaction?

Product FAQ

Answer

The smallest size we have recombined is a 70 bp piece of DNA located between the att sites. Very small pieces are difficult to clone since they negatively influence the topology of the recombination reaction.

Answer Id: E3198

Was this answer helpful?

Yes
No
Thank you for your response

How would you incorporate a leader sequence for secretion into an entry vector?

Product FAQ

Answer

A simple way to express a protein with a leader sequence is to have the leader sequence encoded in the destination vector. The other option is to have the leader sequence subcloned into the entry vector using restriction enzymes, or incorporate the leader sequence into the forward PCR primer when cloning a PCR product into the entry vector. Please see Esposito et al. (2005), Prot. Exp. & Purif. 40, 424-428 for an example of how a partial leader sequence for secretion was incorporated into an entry vector.

Answer Id: E3203

Was this answer helpful?

Yes
No
Thank you for your response

What is the first step in an experiment with the Gateway™ system?

Product FAQ

Answer

The first step is to create an Entry clone for your gene of interest. We have 3 options to do this: The first is by BP recombination reaction using the PCR Cloning System with Gateway™ Technology. This is recommended for cloning large (>5 kb) PCR products. We also have Gateway™ compatible TOPO™ Cloning vectors such as pCR™8/GW/TOPO™ and pENTR™/D-TOPO™. The final option is to use restriction enzymes to clone into a pENTR™ Dual Selection vector.

Answer Id: E3208

Was this answer helpful?

Yes
No
Thank you for your response