Must PCR conditions be changed once the original PCR primers have attB sequence added to them?

Product FAQ

Answer

Since the attB sequences are on the 5' end of oligos, they will not anneal to the target template in the first round of PCR. Sometimes the PCR product is more specific with the attB primers, probably due to the longer annealing sequence (all of attB plus gene specific sequence) after the first round of amplification. Generally there is no need to change PCR reaction conditions when primers have the additional attB sequence

Answer Id: E3222

Was this answer helpful?

Yes
No
Thank you for your response

Is there a way to make baculovirus plaques more visible or distinctive?

Product FAQ

Answer

You can stain the monolayer with neutral red or MTT to make the plaques more visible. Alternatively, you can allow the plates to develop for a few days longer (2-5 days on average) at room temperature to increase the contrast in recombinant plaques. However, the plaques stained with neutral red cannot be used for plaque purification and viral amplification.

Answer Id: E9427

Was this answer helpful?

Yes
No
Thank you for your response

What should I look for to indicate a successful transfection in which baculovirus is produced?

Product FAQ

Answer

Adherent Sf9 cells round up and show a smaller contact point. Infected Sf9 cells in suspension culture round up and look larger when infected.

Answer Id: E9398

Was this answer helpful?

Yes
No
Thank you for your response

Is it possible to co-infect insect cells with two different recombinant viruses in order to co-express, for example, two subunits of a protein?

Product FAQ

Answer

Yes, it is possible. Several five-subunit proteins, such as human replication factor C, have been expressed using recombinant baculovirus. We recommend that a separate high-titer stock (HTS) of each subunit be produced to optimally express the multi-subunit protein. This way, the amount of each subunit expressed can be controlled by varying the multiplicity of infection (MOI) of each subunit's HTS. Please refer to the following articles for more information:

- Chen W and Bhal OP (1991) Recombinant carbohydrate and selnomethionyl variants of human choriogonadotropin. J Biol Chem 266(13):8192-8197.
- Chen WY and Bhal OP (1991) Selenomethionyl analog of recombinant human choriogonadotropin. J Biol Chem 266(15):9355-9358.
- Fabian JR, Kimball SR, Jefferson LS (1998) Reconstitution and purification of eukaryotic initiation factor 2B (eIF2B) expressed in Sf21 insect cells. Protein Expr Purif 13(1):16-22.

Answer Id: E9405

Was this answer helpful?

Yes
No
Thank you for your response

Do you have a recommended single-step protocol for BP/LR recombination?

Product FAQ

Answer

Yes, we have come up with a single-step protocol for BP/LR Clonase™ reaction (http://www.thermofisher.com/us/en/home/life-science/cloning/gateway-cloning.html#1), where DNA fragments can be cloned into Destination vectors in a single step reaction, allowing you to save time and money.

Answer Id: E9857

Was this answer helpful?

Yes
No
Thank you for your response

Do you have recommended sequencing primers for pDONR™201?

Product FAQ

Answer

We do not offer pre-made primers, but we can recommend the following sequences that can be orders as custom primers for sequencing of pDONR™201:
Forward primer, proximal to attL1: 5'- TCGCGTTAACGCTAGCATGGATCTC
Reverse primer, proximal to attL2: 5'-GTAACATCAGAGATTTTGAGACAC

Answer Id: E3236

Was this answer helpful?

Yes
No
Thank you for your response

Is baculovirus good for expressing toxic proteins?

Product FAQ

Answer

Yes, baculovirus is a good candidate for the problem of expressing toxic proteins (i.e., membrane proteins). The polyhedron promoter does not express at maximal levels until 18-24 hr after infection. The polyhedron promoter is active late in the lytic cycle. That being said, it is minimally active as early as 8 hours, so if the gene is very toxic, there may be a problem. The solution in that case would be to switch to an inducible expression system. Transmembrane proteins can often be difficult to express in any system.

Answer Id: E9395

Was this answer helpful?

Yes
No
Thank you for your response

What is the purpose of the Proteinase K step following a Gateway™ LR Recombination reaction, and is it critical to the results?

Product FAQ

Answer

When the LR reaction is complete, the reaction is stopped with Proteinase K and transformed into E. coli resulting in an expression clone containing a gene of interest. A typical LR reaction followed by Proteinase K treatment yields about 35,000 to 150,000 colonies per 20ul reaction. Without the Proteinase K treatment, up to a 10 fold reduction in the number of colonies can be observed. Despite this reduction, there are often still enough colonies containing the gene of interest to proceed with your experiment, so the Proteinase K step can be left out after the LR reaction is complete if necessary.

Answer Id: E4230

Was this answer helpful?

Yes
No
Thank you for your response

What is the influence of the attB sequence on protein function, solubility, folding, and expression?

Product FAQ

Answer

Destination vectors that contain N-terminal fusion partners will express proteins that contain amino acids contributed from the attB1 site, which is 25 bases long. This means that in addition to any tag (6x His and/or antibody epitope tag) the N-terminus of an expressed protein will contain an additional 9 amino acids from the AttB1 sequence - the typical amino acid sequence is Thr-Ser-Leu-Tyr-Lys-Lys-Ala-Gly-nnn, where nnn will depend on the codon sequence of the insert.

Effects on protein function: A researcher (Simpson et al. EMBO Reports 11(31):287-292, 2000) demonstrated that GFP fusions (N- terminal and C-terminal) localized to the proper intracellular compartment. The expression constructs were generated using Gateway™ cloning, so the recombinant protein contained the attB1 or attB2 amino acid sequence. The localization function of the cloned recombinant proteins was preserved.

Effects on expression: We have seen no effect of the attB sites on expression levels in E. coli, insect and mammalian cells. The gus gene was cloned into bacterial expression vectors (for native and N-terminal fusion protein expression) using standard cloning techniques and expressed in bacteria. Gus was also cloned into Gateway™ Destination vectors (for native and N-terminal fusion expression) and expressed. When protein expression is compared, there was no difference in the amount of protein produced. This demonstrates that for this particular case the attB sites do not interfere with transcription or translation.

Effects on solubility: A researcher at the NCI has shown that Maltose Binding Protein fusions constructed with Gateway™ Cloning were soluble. The fusion proteins expressed had the attB amino acid sequence between the Maltose Binding Protein and the cloned protein. It is possible that some proteins containing the attB sequence could remain insoluble when expressed in E.coli.

Effects on folding: Two Hybrids screens show the same interacters identified with and without the attB sequence. Presumably correct protein folding would be required for protein-protein interactions to take place. It is possible that some proteins containing the attB sequence may not fold correctly.

Answer Id: E3223

Was this answer helpful?

Yes
No
Thank you for your response

I’m getting mostly white/wild-type plaques instead of blue/recombinant plaques. What am I doing wrong?

Product FAQ

Answer

This is typically an indication of poor homologous recombination. Check the plasmid/linear DNA ratio you used. If there are some blue plaques, however, expand those viruses and check for their protein. In our experience, they are correct, even if they were in relatively low abundance.

Answer Id: E9474

Was this answer helpful?

Yes
No
Thank you for your response

To propagate more recombinant virus stock, what MOI should I use and when should I harvest the virus?

Product FAQ

Answer

When propagating virus stock, use a low MOI (0.03-0.1) in order to avoid effects of defective interfering particles (DIPs). A low MOI, which ensures no more than 1 virion per cell, prevents the amplification of DIPs. A harvest time based on 15% cell viability is appropriate. NOTE: DIPs are nearly normal virus capsids containing genomes that are defective and are unable to undergo successful replication. While this "particle" is not infectious by itself, it can replicate when co-infected with normal virion, or with some other types of DI particles.

Answer Id: E9428

Was this answer helpful?

Yes
No
Thank you for your response

Which strand is produced using M13K07 to make ssDNA from pPROEX HT or pFastBAC™ vectors?

Product FAQ

Answer

You will get the antisense strand with pProEXHT.
You will get the + or sense strand with pFastBac I of pFastBac™ HT.

Answer Id: E3167

Was this answer helpful?

Yes
No
Thank you for your response

Is it necessary to include a Kozak sequence for expression of recombinant proteins in insect cells?

Product FAQ

Answer

While the importance of a Kozak consensus sequence in translation initiation has been demonstrated in mammalian cells, there seems to be some debate as to whether the Kozak rules are as stringent in insect cells. The only way to determine its importance would be a direct comparison of expression of the same protein from different initiation sequences. Even then, the rules for optimal expression of one protein may not hold for another. Here are two references which indicate that a Kozak consensus sequence does not have any effect on efficiency of expression in insect cells:

- Hills D, Crane-Robinson C (1995) Baculovirus expression of human basic fibroblast growth factor from a synthetic gene: role of the Kozak consensus and comparison with bacterial expression.
- Biochim Biophys Acta 1260(1):14-20.
- Ranjan A, Hasnain SE (1995) Influence of codon usage and translational initiation codon context in the AcNPV-based expression system: computer analysis using homologous and heterologous genes. Virus Genes 9(2):149-153.

Answer Id: E9406

Was this answer helpful?

Yes
No
Thank you for your response

Can I perform the single-step protocol for the BP/LR Clonase™ reaction using BP Clonase™ enzyme and LR Clonase™ enzyme instead of BP Clonase™ II enzyme and LR Clonase™ II enzyme?

Product FAQ

Answer

In the single-step protocol for the BP/LR Clonase™ reaction, we would not recommend substituting the BP Clonase™ II/LR Clonase™ II enzymes with BP Clonase™ /LR Clonase™ enzymes as this would result in very low recombination efficiency.

Answer Id: E9858

Was this answer helpful?

Yes
No
Thank you for your response

Do I have to synthesize new attB primers (29 base attB primer + my specific sequence primer) each time I want to make an attB PCR product, or do you have truncated attB primers that work together with adapter attB primers to get a complete attB sequence?

Product FAQ

Answer

We do have an alternative method called the "attB Adapter PCR" Protocol in which you make your gene specific primer with only 12 additional attB bases and use attB universal adapter primers. This protocol allows for shorter primers to amplify attB-PCR products by utilizing four primers instead of the usual two in a PCR reaction. You can find the sequence of these primers in the protocol on page 45 of the "Gateway™ Technology with Clonase II" manual.

There is a protocol in which all 4 primers mentioned above are in a single PCR reaction. You can find this protocol at in the following article: Quest vol. 1, Issue 2, 2004. The best ratio of the first gene-specific and the second attB primers was 1:10.

Answer Id: E3237

Was this answer helpful?

Yes
No
Thank you for your response