PCR Primers


After cells are isolated from tissue or differentiated from pluripotent precursors, the resulting population needs to be characterized to confirm whether the target population has been obtained. The table below lists PCR primers that can be used in quantitative polymerase chain reactions (qPCR) to measure the expression levels of specific genes for characterizing neural stem cells (NSCs) and their sublineages.

View PCR primers by target

Target Primer         Sequence Tm
Amplicon size (bp) Intron size (bp)
Neural stem cells SOX1-F  GCGGAAAGCGTTTTCTTG 53.0 406 No Intron
  SOX2-F    ATGCACCGCTACGACGTGA 59.3 437  No Intron
Oligodendrocytes MAG-F     TCTGGATTATGATTTCAGCC 49.7 366 159
Astrocytes ALDH1L1-F TCACAGAAGTCTAACCTGCC 55.5 398 21,837
Neurons MAP2-F  CCACCTGAGATTAAGGATCA 55.1 482 11,798
Endogeneous control ACTB-F  ACCATGGATGATGATATCGC 58.2 281 135
GABAergic/Glutaminergic neurons  GAD1-F GTCGAGGACTCTGGACAGTA  55.3 357 12,277
Serotonergic neurons SLC6A4-F GCCTTTTACATTGCTTCCTA 54.8 447 2,251
Cholinergic neurons ChAT-F  ACTGGGTGTCTGAGTACTGG 55.0 451 7,692
Dopaminergic neurons TH-F  TCATCACCTGGTCACCAAGTT 56.0 126 656

