Gateway™ pDEST™10 Vector - FAQs

View additional product information for Gateway™ pDEST™10 Vector - FAQs (11806015)

83 product FAQs found

Can I perform the single-step protocol for the BP/LR Clonase reaction using BP Clonase enzyme and LR Clonase enzyme instead of BP Clonase II enzyme and LR Clonase II enzyme?

In the single-step protocol for the BP/LR Clonase reaction, we would not recommend substituting the BP Clonase II/LR Clonase II enzymes with BP Clonase /LR Clonase enzymes as this would result in very low recombination efficiency.

Do you have a recommended single-step protocol for BP/LR recombination?

Yes, we have come up with a single-step protocol for BP/LR Clonase reaction (http://www.thermofisher.com/us/en/home/life-science/cloning/gateway-cloning.html#1), where DNA fragments can be cloned into Destination vectors in a single step reaction, allowing you to save time and money.

How can I move my gene of interest from a Gateway-adapted expression clone to a new Destination vector as I have lost the entry clone?

We would recommend performing a BP reaction with a Donor vector in order to obtain an entry clone. This entry clone can then be used in an LR reaction with the Destination vector to obtain the new expression clone.

Can I purchase the 5X LR Clonase buffer or 5X BP Clonase buffer separately?

We do not offer the 5X LR Clonase buffer and 5X BP Clonase buffer as standalone products. They are available as part of the enzyme kits.

Do you offer Gateway vectors for expression in plants?

We do not offer any Gateway vectors for expression in plants.

I cannot grow this white colony in liquid culture. What should I do?

The concentration of gentamicin might be too high. Try lowering the amount to 5 µg/mL and try adding more of the colony to the culture medium.

What has happened when I see blue colonies? How about colonies which are blue in the center and white on the edges?

In the case of a blue colony, the E. coli has the bacmid and the plasmid in it, allowing the cells to survive the selection process. However, because the transposition has not occurred, the LacZ gene is not disrupted. For bulls-eye colonies, this indicates that the transposition took place when the colony was growing. Re-streaking for an isolated clone from the white portion of the mixed colony should yield some colonies where transposition occurred.

I'm getting mostly white/wild-type plaques instead of blue/recombinant plaques. What am I doing wrong?

This is typically an indication of poor homologous recombination. Check the plasmid/linear DNA ratio you used. If there are some blue plaques, however, expand those viruses and check for their protein. In our experience, they are correct, even if they were in relatively low abundance.

I've infected my cells and see large polyhedra in one cell and smaller polyhedra (more numerous) in a neighboring cell. Is this normal?

Yes, cells are infected with wild-type virus individually and will develop polyhedra at different rates until all the cells in the flask are infected. The polyhedra in cells will form in approximately 3-4 days, differing in size and number until they reach their maximum capacity and burst the cell, releasing tiny particles of virus into the medium.

I'm worried that I am not getting plaques. How many days does it take to see plaques and what size are they typically?

Normally, very small white dots show up about 5-7 days and 1 mm plaques show up around day 10. Plaques can vary in size from 1 mm to 4 mm.

I forgot to add Bluo-gal to my plates. Can I add it later?

On the day you intend to pick plaques, make a solution of Bluo-gal in DMSO at 20 mg/mL. Add 50 µL per plate and spread with a glass spreader under sterile conditions. Wait 30-60 min, and your plaques should turn blue.

What might cause plates to turn blue along with blue plaques?

There are a few things that can turn plates blue:

- Too much virus when plating. Try a higher dilution.
- Cells are being singed when plated with hot melted agarose. This lyses the cells and releases lacZ into the agarose, turning it blue. Double-check plating temperatures. If plates are too wet, the blue can diffuse.

After addition of the agarose overlay to my cells, they look like crescents or are granular. What happened?

The agarose overlay was too hot. After addition of the agarose overlay, cells should still be round and healthy.

My agarose overlay is floating. Is this because I did not aspirate the medium completely?

Yes, this is indicative of an aspirating problem on the plaques. The agarose overlays were “floating” because the medium was not completely aspirated from the plates. The plates need to be completely dry before the agarose is placed over the cells, especially when plaques will be picked. To do this, we typically tip the plate slightly and keep going around the rim of the plate with the Pasteur pipette tip, being careful not to disturb the cell monolayer. If any medium pooling at the rims of the plates (they will be small pools) is seen, continue to aspirate. This “floating” agarose overlay problem may also result in wild-type contamination. The wild-type virus is able to migrate to other portions of the plates and contaminate recombinant plaques. Wild-type virus replicates much faster than recombinant virus, and can quickly overwhelm the recombinant virus.

I see what looks like small plaques, but they are too difficult to visualize. What could be the problem?

Too many cells were seeded; we recommend seeding 8 x 10e5 cells per well for a 6-well plate.

I think I've added too much virus. How important is the MOI? What happens if too much virus is used?

An MOI of 5-10 is typically used. If too much virus is added, unfortunately the cells die too soon and the protein expression level goes down.

I'm yielding no plaques from my baculovirus plaque assay. What are the possible causes for this?

The kinetics of infection may be slower than expected. Observe plates until the 8-9th day after infection. If no plaques appear, investigate the following:

- If the cells are not healthy, then poor-quality or no plaques can result. Ideally, cells should be in mid-log phase and have a viability of greater than 90%. Cells should double at least once before infection stops growth. Ensure that the correct amount of cells was used at ~70% confluency.
- The viral replication cycle can be inhibited due to poor nutritional and physical conditions of the cell.
- The temperature of the agarose is also crucial. After overlaying the agarose, the plates should be left untouched for 1 hour for the agarose to completely solidify.
- Excessive condensation during incubation at 27 degrees C can inhibit plaque formation-remove paper towels or open the container containing plates as soon as condensation appears.
- The viral titer is too low: Use a higher viral titer. You may need to re-infect your cells and collect a higher titer of your viral stock.

Can an old low-titer stock be used to make a high-titer stock?

If this lower-titer stock is a P1 or P2 stock, a viral amplification protocol can be used. If the low-titer stock was once a high-titer stock, but has dropped titer due to age or the stock was propagated many generations, then it may be necessary to regenerate the high-titer stock. If the high titer stock is >P5, then there may be an excessive amount of defective interfering particles that infect cells but do not properly replicate or produce protein. If the existing stock is plated out and a fresh plaque is re-isolated (DIPs do not form plaques), a new high-titer stock can be established.

Can a P3 viral stock be used to generate more viruses? How about a P4 or P5 stock?

Yes, the same protocol used to make your P2 viral stock can be used to make a P3, P4, or P5 viral stock. We don't recommend making the stock higher than P5, as more defective interfering particles will be produced and a decrease in protein expression level will occur.

Can the bacluovirus infect mammalian cells? How about Drosophila cells?

Yes, baculovirus can infect mammalian cells, although only at very high titers. Baculovirus works best in liver cells. However, there is no danger of cross-contamination unless the cells are directly infected with the high-titer stocks. Bacuolvirus can infect Drosophila cells; however, it will not replicate in these cells. The promoters used to drive expression of your gene in a typical baculovirus system are both late promoters and require earlier proteins from the baculovirus genome. Thus, they will not work in S2 cells since the early proteins are not made.

How many cells need to be infected in a 12-well plate with 1 plaque?

Typically, 0.5 x 106 cells per well in 2.5-3 mL is a good starting point. Lysis should begin by day 3. Virus may be harvested and amplified between 3 and 7 days (90% cell death).

I'd like to perform PCR on a plaque, and also make a stock from the same plaque. How do you suggest I do this?

Our R&D team will typically pick a plug and add it to a 12-well dish with 0.5 x 10e6 cells/well and 2.5 mL total volume per well. After approximately 3 days, remove 0.75 mL to make DNA for PCR and keep the remaining medium in an Eppendorf tube as your P1 viral stock. As an aside, it is okay to pick a plaque and store it in Grace's medium.

What is the optimal time for harvesting high-titer virus following infection? What happens if I let the cells go longer?

We recommend harvesting high-titer virus when there is 90% cell lysis. This takes approximately 5-7 days. If the cells go longer, the proteases released from the lysed cells will start to degrade viral surface proteins and result in less infectious virus.

After infecting T25 or T75 flasks with virus, when do you begin to see cell lysis and what percentage of cells will be lysed at certain time points?

This is dependent on how much virus is added. If cells are infected at an MOI of 5, usually cells are infected at 24 hours, and cells begin to lyse at around 65 hours. If less virus is used, this takes longer, and more virus takes less time.

To propagate more recombinant virus stock, what MOI should I use and when should I harvest the virus?

When propagating virus stock, use a low MOI (0.03-0.1) in order to avoid effects of defective interfering particles (DIPs). A low MOI, which ensures no more than 1 virion per cell, prevents the amplification of DIPs. A harvest time based on 15% cell viability is appropriate. NOTE: DIPs are nearly normal virus capsids containing genomes that are defective and are unable to undergo successful replication. While this "particle" is not infectious by itself, it can replicate when co-infected with normal virion, or with some other types of DI particles.

Is there a way to make baculovirus plaques more visible or distinctive?

You can stain the monolayer with neutral red or MTT to make the plaques more visible. Alternatively, you can allow the plates to develop for a few days longer (2-5 days on average) at room temperature to increase the contrast in recombinant plaques. However, the plaques stained with neutral red cannot be used for plaque purification and viral amplification.

What viral titer do you suggest having to infect my cells?

We suggest using a viral stock with a titer of >1 x 10e8 pfu/mL for expression studies.

What is the equation to calculate viral titer? Do you have an example I can use?

Please see the equation below:
pfu/mL = number of plaques (pfu)/dilution factor x mL of inocula
So, if you have a well with viral dilution of 10-8 containing 18 white plaques, the viral titer is calculated as followed:
X pfu/mL = 18 pfu/10-8 x 1 mL
X = 1.8 x 10e9 pfu/mL

Can you outline the main steps of performing a plaque assay, and any suggestions when performing this assay?

Please see the method below for an outline of the main steps of performing a plaque assay:

- Plate cells at 80% confluency in a 6-well plate
- Make a serial dilution of the P1 viral stock (1-10-5) and add to cells
- Incubate for an hour at 27 degrees C
- Mix 1% melted agarose into the medium
- Remove the viral supernatant
- Overlay the cells with the medium containing agarose
- Leave the plates for 2-3 hours for agar to completely solidify
- Incubate plates for 10-14 days
- Count plaques

When performing this assay, we suggest:

- Use cells that are in excellent health, of low passage (10-20) in log-phase growth, and high viability (>95%)
- Check viral stock for sterility (free of contamination)
- Use high-quality, low melting point agarose
- The temperature of the medium with agarose is crucial-too hot, cells will die; but if too cold, it will solidify too quickly
- Wait 2-4 hours before removing the plate after overlay so that the agarose can 100% solidify
- Count plaques on a dilution plate where (1/dilution) x # of plaques = pfu/mL
e.g., if you have 50 plaques on the 10-6 plate, then you have 1(10-6) x 50 = 5 x 10e7 pfu/mL

How do I determine the titer of my viral stock?

We recommend you perform a plaque assay to determine the titer of your viral stock. You may also perform a plaque assay to purify a single viral clone, if desired.

I performed my PCR and see different banding patterns. What do the different PCR sizes mean?

The expected PCR size will depend on the pFastBac vector that got transposed into the bacmid:

- Bacmid alone: 300 bp
- With pFastBac 1: 2300 bp + size of insert
- With pFastBac 1-Gus: 4200 bp
- With pFastBac HT: 2430 bp + size of insert
- With pFastBac HT-CAT: 3075 bp
- With pFastBac Dual: 2560 bp + size of insert
- With pFastBac Dual-Gus/CAT: 5340 bp
- With pDEST8: 2316 bp + size of insert
- With pDEST10: 2484 bp + size of insert
- With pDEST20: 3031 bp + size of insert

Do I need to include a Kozak sequence for expression of recombinant proteins in insect cells?

While the importance of a Kozak consensus sequence in translation initiation has been demonstrated in mammalian cells, there seems to be some debate as to whether the Kozak rules are as stringent in insect cells. The only way to determine its importance would be a direct comparison of expression of the same protein from different initiation sequences. Even then, the rules for optimal expression of one protein may not hold for another. Here are two references which indicate that a Kozak consensus sequence does not have any effect on efficiency of expression in insect cells:

- Hills D, Crane-Robinson C (1995) Baculovirus expression of human basic fibroblast growth factor from a synthetic gene: role of the Kozak consensus and comparison with bacterial expression.
- Biochim Biophys Acta 1260(1):14-20.
- Ranjan A, Hasnain SE (1995) Influence of codon usage and translational initiation codon context in the AcNPV-based expression system: computer analysis using homologous and heterologous genes. Virus Genes 9(2):149-153.

Is it possible to co-infect insect cells with two different recombinant viruses in order to co-express, for example, two subunits of a protein?

Yes, it is possible. Several five-subunit proteins, such as human replication factor C, have been expressed using recombinant baculovirus. We recommend that a separate high-titer stock (HTS) of each subunit be produced to optimally express the multi-subunit protein. This way, the amount of each subunit expressed can be controlled by varying the multiplicity of infection (MOI) of each subunit's HTS. Please refer to the following articles for more information:

- Chen W and Bhal OP (1991) Recombinant carbohydrate and selnomethionyl variants of human choriogonadotropin. J Biol Chem 266(13):8192-8197.
- Chen WY and Bhal OP (1991) Selenomethionyl analog of recombinant human choriogonadotropin. J Biol Chem 266(15):9355-9358.
- Fabian JR, Kimball SR, Jefferson LS (1998) Reconstitution and purification of eukaryotic initiation factor 2B (eIF2B) expressed in Sf21 insect cells. Protein Expr Purif 13(1):16-22.

What is the multiplicity of infection, and how can I calculate it?

The MOI, or multiplicity of infection, is the average number of viral particles that infect a single cell in a specific experiment. You can calculate the MOI with the following equation:
MOI (pfu/cell) = [titer (pfu) x viral stock volume (mL) used in inocula] / [cell density (cells/mL) x culture volume (mL)]

Can I scale-up the production of recombinant protein using the baculovirus expression system? If so, what methods are available?

Yes, large-scale expression experiments can be performed. Please see below for different large-scale methods, requirements, added benefits, and references:
- Stirred bioreactor
- Airlift fermentor
- Insect larvae

How can I store my viral stock?

If the medium is serum-free, add serum to 10%. Serum proteins act as substrates for proteases and therefore prevent degradation of viral coat proteins. Store viral stocks at 4 degrees C, and protect from light. Aliquots can be stored at -80 degrees C, but viral titer should be checked before use, as freeze/thaw cycles of the virus can result in a 10- to 100-fold decrease in viral titer.

Do I need to purify my recombinant virus away from an uncut or non-recombinant viral DNA?

Yes. Contamination of your recombinant DNA with uncut occlusion body positive (occ+) DNA will lead to dilution of your recombinant virus over time because, in general, uncut (wild-type, occ+) virus infects and replicates at higher efficiency than recombinant virus. Also, initiating expression studies with a pure, single virus population will ensure reproducible results.

What does viral infection look like in early, late, and very late stages?

Please see the description below of the different stages of viral infection:

Early
- Increased cell diameter-a 25-50% increase in the diameter of the cells may be observed.
- Increased size of cell nuclei-the nuclei may appear to "fill" the cells.

Late
- Cessation of cell growth-cells appear to stop growing when compared to a cell-only control.
- Granular appearance
- Signs of viral budding-vesicular appearance of cells.
- Viral occlusions-few cells will contain occlusion bodies, which appear as refractive crystals in the nucleus of the insect cell.
- Detachment-cells release from the dish or flask.

Very late
- Cell lysis-a few cells may fill with occluded virus, die, and burst, leaving signs of clearing in the monolayer.

What should I look for to indicate a successful transfection in which baculovirus is produced?

Adherent Sf9 cells round up and show a smaller contact point. Infected Sf9 cells in suspension culture round up and look larger when infected.

What are some general suggestions for transfection in baculovirus expression systems?

Please follow the recommendations below:

- Cells should be in excellent health, of their low passages (5-15), in log-phase growth, with viability >95%
- DNA must be of high purity, free of endotoxin
- No antibiotics should be used during transfection
- Cellfectin reagent has to be completely resuspended
- Include controls (media control, DNA control, and transfection reagent control) for comparison and troubleshooting

When should I harvest my protein after I have inoculated my insect cells with recombinant virus?

Peak expression of protein in insect cells is dependent on the multiplicity of infection (MOI), expression time, and the protein being expressed. Guidelines to optimize your system include using an MOI of 5-10 and an expression time of 48-72 hours. Protein expressed at times later than 72 hours may be processed aberrantly, because the large virus load can cause a breakdown of cellular processes.

Is baculovirus good for expressing toxic proteins?

Yes, baculovirus is a good candidate for the problem of expressing toxic proteins (i.e., membrane proteins). The polyhedron promoter does not express at maximal levels until 18-24 hr after infection. The polyhedron promoter is active late in the lytic cycle. That being said, it is minimally active as early as 8 hours, so if the gene is very toxic, there may be a problem. The solution in that case would be to switch to an inducible expression system. Transmembrane proteins can often be difficult to express in any system.

Do I need to include a ribosomal binding site (RBS/Shine Dalgarno sequence) or Kozak sequence when I clone my gene of interest?

ATG is often sufficient for efficient translation initiation although it depends upon the gene of interest. The best advice is to keep the native start site found in the cDNA unless one knows that it is not functionally ideal. If concerned about expression, it is advisable to test two constructs, one with the native start site and the other with a Shine Dalgarno sequence/RBS or consensus Kozak sequence (ACCAUGG), as the case may be. In general, all expression vectors that have an N-terminal fusion will already have a RBS or initiation site for translation.

Find additional tips, troubleshooting help, and resources within our Protein Expression Support Center.

How large of a PCR product can I recombine with a pDONR vector via BP cloning? Does the same apply for TOPO-adapted Entry vectors?

There is no theoretical limit to insert size for a BP reaction with a pDONR vector. Maximum size tested in-house is 12 kb. TOPO vectors are more sensitive to insert size and 3-5 kb is the upper limit for decent cloning efficiency.

How should I clean up my attB-PCR product?

After generating your attB-PCR product, we recommend purifying it to remove PCR buffer, unincorporated dNTPs, attB primers, and any attB primer-dimers. Primers and primer-dimers can recombine efficiently with the Donor vector in the BP reaction and may increase background after transformation into E. coli, whereas leftover PCR buffer may inhibit the BP reaction. Standard PCR product purification protocols using phenol/chloroform extraction followed by ammonium acetate and ethanol or isopropanol precipitation are not recommended for purification of the attB-PCR product as these protocols generally have exclusion limits of less than 100 bp and do not efficiently remove large primer-dimer products. We recommend a PEG purification protocol (see page 17 of the Gateway Technology with Clonase II manual). If you use the above protocol and your attB-PCR product is still not suitably purified, you may further gel-purify the product. We recommend using the PureLink Quick Gel Extraction kit.

I'm trying to propagate my Gateway destination vector and am not seeing any colonies. What should I do?

Check the genotype of the cell strain you are using. Our Gateway destination vectors typically contain a ccdB cassette, which, if uninterrupted, will inhibit E. coli growth. Therefore, un-cloned vectors should be propagated in a ccdB survival cell strain, such as our ccdB Survival 2 T1R competent cells.

What is the difference between LR Clonase II and LR Clonase II Plus?

LR Clonase II Plus contains an optimized formulation of recombination enzymes for use in MultiSite Gateway LR reactions. LR Clonase and LR Clonase II enzyme mixes are not recommended for MultiSite Gateway LR recombination reactions, but LR Clonase II Plus is compatible with both multi-site and single-site LR recombination reactions.

What is the purpose of the Proteinase K step following a Gateway LR Recombination reaction, and is it critical to the results?

When the LR reaction is complete, the reaction is stopped with Proteinase K and transformed into E. coli resulting in an expression clone containing a gene of interest. A typical LR reaction followed by Proteinase K treatment yields about 35,000 to 150,000 colonies per 20ul reaction. Without the Proteinase K treatment, up to a 10 fold reduction in the number of colonies can be observed. Despite this reduction, there are often still enough colonies containing the gene of interest to proceed with your experiment, so the Proteinase K step can be left out after the LR reaction is complete if necessary.

Can I go directly from a pENTR/D-TOPO reaction into an LR Clonase Reaction without first purifying the DNA?

In most cases, there will not be enough pENTR vector DNA present to go directly from TOPO cloning into an LR reaction. You need between 100-300 ng of pENTR vector for an efficient LR reaction, and miniprep of a colony from the TOPO transformation is necessary to obtain that much DNA. However, if you want to try it, here are some recommendations for attempting to go straight into LR reactions from the TOPO reaction using pENTR/D, or SD TOPO, or pCR8/GW/TOPO vectors:

1. Heat inactivate the topoisomerase after the TOPO cloning reaction by incubating the reaction at 85 degrees C for 15 minutes.
2. Use the entire reaction (6 µL) in the LR clonase reaction. No purification steps are necessary.
3. Divide the completed LR reaction into 4 tubes and carry out transformations with each tube. You cannot transform entire 20 µL reaction in one transformation, and we have not tried ethanol precipitation and then a single transformation.

When attempting this protocol, we observed very low efficiencies (~10 colonies/plate). So just be aware that while technically possible, going directly into an LR reaction from a TOPO reaction is very inefficient and will result in a very low colony number, if any at all.

Can N-terminal or C-terminal tags be attached to a Gateway Entry clone?

To have an N-terminal tag, the gene of interest must be in the correct reading frame when using non-TOPO adapted Gateway entry vectors. All TOPO adapted Gateway Entry vectors will automatically put the insert into the correct reading frame, and to add the N-terminal tag you simply recombine with a destination vector that has N-terminal tag.

To attach a C-terminal tag to your gene of interest, the insert must lack its stop codon, and be in the correct reading frame for compatibility with our C-terminal tagged destination vectors. Again, TOPO adapted Gateway Entry vectors will automatically put the insert into the correct reading frame. If you do not want the C-terminal tag to be expressed, simply include a stop codon at the end of the insert that is in frame with the initial ATG.

Generally, you need to choose a destination vector before you design and clone your insert into the Entry vector. This will determine whether you need to include an initiating ATG or stop codon with your insert.

Can you tell me the difference between a Shine-Dalgarno sequence and a Kozak sequence?

Prokaryotic mRNAs contain a Shine-Dalgarno sequence, also known as a ribosome binding site (RBS), which is composed of the polypurine sequence AGGAGG located just 5’ of the AUG initiation codon. This sequence allows the message to bind efficiently to the ribosome due to its complementarity with the 3’-end of the 16S rRNA. Similarly, eukaryotic (and specifically mammalian) mRNA also contains sequence information important for efficient translation. However, this sequence, termed a Kozak sequence, is not a true ribosome binding site, but rather a translation initiation enhancer. The Kozak consensus sequence is ACCAUGG, where AUG is the initiation codon. A purine (A/G) in position -3 has a dominant effect; with a pyrimidine (C/T) in position -3, translation becomes more sensitive to changes in positions -1, -2, and +4. Expression levels can be reduced up to 95% when the -3 position is changed from a purine to pyrimidine. The +4 position has less influence on expression levels where approximately 50% reduction is seen. See the following references:

- Kozak, M. (1986) Point mutations define a sequence flanking the AUG initiator codon that modulates translation by eukaryotic ribosomes. Cell 44, 283-292.
- Kozak, M. (1987) At least six nucleotides preceding the AUG initiator codon enhance translation in mammalian cells. J. Mol. Biol. 196, 947-950.
- Kozak, M. (1987) An analysis of 5´-noncoding sequences from 699 vertebrate messenger RNAs. Nucleic Acids Res. 15, 8125-8148.
- Kozak, M. (1989) The scanning model for translation: An update. J. Cell Biol. 108, 229-241.
- Kozak, M. (1990) Evaluation of the fidelity of initiation of translation in reticulocyte lysates from commercial sources. Nucleic Acids Res. 18, 2828.

Note: The optimal Kozak sequence for Drosophila differs slightly, and yeast do not follow this rule at all. See the following references:

- Romanos, M.A., Scorer, C.A., Clare, J.J. (1992) Foreign gene expression in yeast: a review. Yeast 8, 423-488.
- Cavaneer, D.R. (1987) Comparison of the consensus sequence flanking translational start sites in Drosophila and vertebrates. Nucleic Acids Res. 15, 1353-1361.

Find additional tips, troubleshooting help, and resources within our Protein Expression Support Center.

Can an attB-PCR product be cloned directly into an expression (Gateway Destination) vector?

No, not directly. The attB-PCR product must first be cloned, via a BP Clonase reaction, into a pDONR vector which creates an "Entry Clone" with attL sites. This clone can then be recombined, via an LR Clonase reaction, with a Destination vector containing attR sites. However, It is possible to perform both of these reactions in one step using the "One-Tube Protocol" described in the manual entitled "Gateway Technology with Clonase II".

Can Gateway technology be used to express two proteins from the same vector?

Yes, this can be done using the Multisite Gateway Technology. MultiSite Gateway Pro Technology enables you to efficiently and conveniently assemble multiple DNA fragments - including genes of interest, promoters, and IRES sequences - in the desired order and orientation into a Gateway Expression vector. Using specifically designed att sites for recombinational cloning, you can clone two, three, or four DNA fragments into any Gateway Destination vector containing attR1 and attR2 sites. The resulting expression clone is ready for downstream expression and analysis applications.

What is the efficiency of recombination in the Gateway system?

For the BP reaction, approximately 5-10% of the starting material is converted into product. For the LR reaction, approximately 30% of the starting material is converted into product.

Are there common restriction sites that can be used to excise a gene out of a Gateway plasmid?

The core region of the att sites contains the recognition sequence for the restriction enzyme BsrGI. Provided there are no BsrGI sites in the insert, this enzyme can be used to excise the full gene from most Gateway plasmids. The BsrGI recognition site is 5'-TGTACA and is found in both att sites flanking the insertion site.

If a different restriction site is desired, the appropriate sequence should be incorporated into your insert by PCR.

Do I have to synthesize new attB primers (29 base attB primer + my specific sequence primer) each time I want to make an attB PCR product, or do you have truncated attB primers that work together with adapter attB primers to get a complete attB sequence?

We do have an alternative method called the "attB Adapter PCR" Protocol in which you make your gene specific primer with only 12 additional attB bases and use attB universal adapter primers. This protocol allows for shorter primers to amplify attB-PCR products by utilizing four primers instead of the usual two in a PCR reaction. You can find the sequence of these primers in the protocol on page 45 of the "Gateway Technology with Clonase II" manual.

There is a protocol in which all 4 primers mentioned above are in a single PCR reaction. You can find this protocol at in the following article: Quest vol. 1, Issue 2, 2004. https://www.thermofisher.com/us/en/home/references/newsletters-and-journals/quest-archive.reg.in.html. The best ratio of the first gene-specific and the second attB primers was 1:10.

Do you have recommended sequencing primers for pDONR201?

We do not offer pre-made primers, but we can recommend the following sequences that can be ordered as custom primers for sequencing of pDONR201:
Forward primer, proximal to attL1: 5'- TCGCGTTAACGCTAGCATGGATCTC
Reverse primer, proximal to attL2: 5'-GTAACATCAGAGATTTTGAGACAC

Can you please list some references for Gateway Cloning Technology?

1. Yeast two-hybrid protein-protein interaction studies Walhout AJ, Sordella R, Lu X, Hartley JL, Temple GF, Brasch MA, Thierry-Mieg N, Vidal M.

2. Protein Interaction Mapping in C. elegans Using Proteins Involved in Vulval Development. Science Jan 7th 2000; 287(5450), 116-122 Davy, A. et al.

3. A protein-protein interaction map of the Caenorhabditis elegans 26S proteosome. EMBO Reports (2001) 2 (9), p. 821-828. Walhout, A.J.M. and Vidal, M. (2001).

4. High-throughput Yeast Two-Hybrid Assays for Large-Scale Protein Interaction mapping. Methods: A Companion to Methods in Enzymology 24(3), pp.297-306

5. Large Scale Analysis of Protein Complexes Gavin, AC et al. Functional Organization of the Yeast Proteome by Systematic Analysis of Protein Complexes. Nature Jan 10th 2002, 415, p. 141-147.

6. Systematic subcellular localisation of proteins Simpson, J.C., Wellenreuther, R., Poustka, A., Pepperkok, R. and Wiemann, S.

7. Systematic subcellular localization of novel proteins identified by large-scale cDNA sequencing. EMBO Reports (2000) 1(3), pp. 287-292.

8. Protein-over expression and crystallography Evdokimov, A.G., Anderson, D.E., Routzahn, K.M. & Waugh, D.S.

9. Overproduction, purification, crystallization and preliminary X-ray diffraction analysis of YopM, an essential virulence factor extruded by the plague bacterium Yersinia pestis. Acta Crystallography (2000) D56, 1676-1679.

10. Evdokimov, et al. Structure of the N-terminal domain of Yersinia pestis YopH at 2.0 A resolution. Acta Crystallographica D57, 793-799 (2001).

11. Lao, G. et al. Overexpression of Trehalose Synthase and Accumulation of Intracellular Trehalose in 293H and 293FTetR:Hyg Cells. Cryobiology 43(2):106-113 (2001).

12. High-throughput cloning and expression Albertha J. M. Walhout, Gary F. Temple, Michael A. Brasch, James L. Hartley, Monique A. Lorson, Sander Van Den Huevel, and Marc Vidal.

13. Gateway Recombinational Cloning: Application to the Cloning of Large Numbers of Open Reading Frames or ORFeomes. Methods in Enzymology, Vol. 328, 575-592.

14. Wiemann, S. et.al., Toward a Catalog of Human Genes and Proteins: Sequencing and Analysis of 500 Novel Complete Protein Coding Human cDNAs, Genome Research (March 2001) Vol. 11, Issue 3, pp.422-435

15. Reviewed in NATURE: Free Access to cDNA provides impetus to gene function work. 15 march 2001, p. 289. Generating directional cDNA libraries using recombination

16. Osamu Ohara and Gary F. Temple. Directional cDNA library construction assisted by the in vitro recombination reaction. Nucleic Acids Research 2001, Vol. 29, no. 4. RNA interference (RNAi)

17. Varsha Wesley, S. et al. Construct design for efficient, effective and highthroughput gene silencing in plants. The Plant Journal 27(6), 581-590 (2001). Generation of retroviral constructs

18. Loftus S K et al. Generation of RCAS vectors useful for functional genomic analyses. DNA Res 31;8(5):221 (2001).

19. James L. Hartley, Gary F. Temple and Michael A. Brasch. DNA Cloning Using In Vitro Site-Specific Recombination. Genome Research (2000) 10(11), pp. 1788-1795.

20. Reboul et al. Open-reading frame sequence tags (OSTs) support the existence of at least 17,300 genes in C. elegans. Nature Genetics 27(3):332-226 (2001).

21. Kneidinger, B. et al. Identification of two GDP-6-deoxy-D-lyxo-4-hexulose reductase synthesizing GDP-D-rhamnose in Aneurinibacillus thermoaerophilus L420-91T*. JBC 276(8) (2001).

What do attL1 and attL2 sites look like after recombination between attB and attP sites?

The attP1 sequence (pDONR) is:
AATAATGATT TTATTTTGAC TGATAGTGAC CTGTTCGTTG CAACAAATTG ATGAGCAATGCTTTTTTAT AATGCCAACT TTGTACAAAA AAGC[TGAACG AGAAACGTAA AATGATATAA ATATCAATAT ATTAAATTAG ATTTTGCATA AAAAACAGACTA CATAATACTG TAAAACACAA CATATCCAGT CACTATGAAT CAACTACTTA GATGGTATTA GTGACCTGTA]

The region within brackets is where the site is "cut" and replaced by the attB1-fragment sequence to make an attL1 site. The sequence GTACAAA is the overlap sequence present in all att1 sites and is always "cut" right before the first G.

The overlap sequence in attP2 sites is CTTGTAC and cut before C. This is attP2:
ACAGGTCACT AATACCATCT AAGTAGTTGA TTCATAGTGA CTGGATATGT TGTGTTTTAC AGTATTATGT AGTCTGTTTT TTATGCAAAA TCTAATTTAA TATATTGATA TTTATATCAT TTTACGTTTC TCGTTCAGCT TTCTTGTACA AAGTTGGCAT TATAAGAAAG CATTGCTTAT AATTTGTTG CAACGAACAG GTCACTATCA GTCAAAATAA AATCATTATT

So, attL1 (Entry Clone) should be:
A ATAATGATTT TATTTTGACT GATAGTGACC TGTTCGTTGC AACAAATTGA TGAGCAATGC TTTTTTATAA TGCCAACT TT G TAC AAA AAA GC[A GGC T]NN NNN

attL2 (Entry Clone) should be:
NNN N[AC C]CA GCT TT CTTGTACA AAGTTGGCAT TATAAGAAAG CATTGCTTAT CAATTTGTTG CAACGAACAG GTCACTATCA GTCAAAATAA AATCATTATT

The sequence in brackets comes from attB, and N is your gene-specific sequence.

Note: When creating an Entry Clone through the BP reaction and a PCR product, the vector backbone is not the same as Gateway Entry vectors. The backbone in the case of PCR BP cloning is pDONR201.

How large can PCR fragments be and still be cloned into a Gateway Entry vector?

There is no size restriction on the PCR fragments if they are cloned into a pDONR vector. The upper limit for efficient cloning into a TOPO adapted Gateway Entry vector is approximately 5 kb. A Gateway recombination reaction can occur between DNA fragments that are as large as 150 kb.

What is the influence of the attB sequence on protein function, solubility, folding, and expression?

Destination vectors that contain N-terminal fusion partners will express proteins that contain amino acids contributed from the attB1 site, which is 25 bases long. This means that in addition to any tag (6x His and/or antibody epitope tag), the N-terminus of an expressed protein will contain an additional 9 amino acids from the attB1 sequence - the typical amino acid sequence is Thr-Ser-Leu-Tyr-Lys-Lys-Ala-Gly-nnn, where nnn will depend on the codon sequence of the insert.

Effects on protein function: A researcher (Simpson et al. EMBO Reports 11(31):287-292, 2000) demonstrated that GFP fusions (N- terminal and C-terminal) localized to the proper intracellular compartment. The expression constructs were generated using Gateway cloning, so the recombinant protein contained the attB1 or attB2 amino acid sequence. The localization function of the cloned recombinant proteins was preserved.

Effects on expression: We have seen no effect of the attB sites on expression levels in E. coli, insect and mammalian cells. The gus gene was cloned into bacterial expression vectors (for native and N-terminal fusion protein expression) using standard cloning techniques and expressed in bacteria. Gus was also cloned into Gateway Destination vectors (for native and N-terminal fusion expression) and expressed. When protein expression is compared, there was no difference in the amount of protein produced. This demonstrates that for this particular case, the attB sites do not interfere with transcription or translation.

Effects on solubility: A researcher at the NCI has shown that Maltose Binding Protein fusions constructed with Gateway Cloning were soluble. The fusion proteins expressed had the attB amino acid sequence between the Maltose Binding Protein and the cloned protein. It is possible that some proteins containing the attB sequence could remain insoluble when expressed in E.coli.

Effects on folding: Two Hybrids screens show the same interacters identified with and without the attB sequence. Presumably correct protein folding would be required for protein-protein interactions to take place. It is possible that some proteins containing the attB sequence may not fold correctly.

Must PCR conditions be changed once the original PCR primers have attB sequence added to them?

Since the attB sequences are on the 5' end of oligos, they will not anneal to the target template in the first round of PCR. Sometimes the PCR product is more specific with the attB primers, probably due to the longer annealing sequence (all of attB plus gene specific sequence) after the first round of amplification. Generally there is no need to change PCR reaction conditions when primers have the additional attB sequence

What is the smallest quantity of RNA detectable by the SuperScript IV First-Strand System for RT-PCR?

Detection limits dependend on many factors, including primer design, target size, and the abundance of mRNA. The recommended template amount when working with SuperScript IV Reverse Transcriptase is 10 pg-5 µg total RNA or 10 pg-500 ng mRNA.

How does adding Platinum Taq DNA Polymerase improve SuperScript One-Step RT-PCR performance?

Platinum Taq DNA Polymerase is precomplexed with a mixture of antibodies that inhibit polymerase activity until the initial denaturation step in PCR. As a result, nonspecific polymerase acitivty at lower temperatures during set-up and reverse transcription is eliminated, which provides greater yield and specificity of intended product.

What size targets can be amplified by the SuperScript One-Step RT-PCR Systems?

The SuperScript III One-Step RT-PCR System with Platinum Taq DNA Polymerase is recommended for amplifying RNA targets up to 4.5 kb and the SuperScript IV UniPrime One-Step RT-PCR System is recommended for amplifying RNA targets up to 13 kb.

Can PCR primers be tailed directly with attL sites for direct recombination into the destination vector?

No, this is not really feasible due to the fact that the attL sequence is approximately 100 bp, which is too long for efficient oligo synthesis. Our own maximum sequence length for ordering custom primers is 100 nucleotides. In contrast, the attB sequences are only 25 bp long, which is a very reasonable length for adding onto the 5' end of gene-specific PCR primers.

How stable are your cationic lipids that are used in transfection?

All the following lipids are stable at 4º C for at least one year:
11668-019 Lipofectamine 2000
10362-100 Cellfectin II
10459-014 DMRIE-C
10964-013 Lipofectamine PLUS
18292-011 Lipofectin
18324-012 Lipofectamine


Find additional tips, troubleshooting help, and resources within our Transfection Support Center.

Where can I get Gateway vector sequences and maps?

Vector information can be found in the product manuals or directly on our web site by entering the catalog number of the product in the search box. The vector map, cloning site diagram, and sequence information will be linked to the product page.

From where does Gateway get its lambda nomenclature, and is it consistent with textbook nomenclature for lambda recombination?

The Gateway nomenclature is consistent with lambda nomenclature, but we use numbers to differentiate between modified versions of the att sites (attB1, attB2, attP1, attP2, and so on). We have introduced mutations in the att sites to provide specificity and directionality to the recombination reaction. For example, attB1 will only recombine with attP1 and not with attP2.

What is the first step in an experiment with the Gateway system?

The first step is to create an Entry clone for your gene of interest. We have 3 options to do this: The first is by BP recombination reaction using the PCR Cloning System with Gateway Technology. This is recommended for cloning large (>5 kb) PCR products. We also have Gateway compatible TOPO Cloning vectors such as pCR8/GW/TOPO and pENTR/D-TOPO. The final option is to use restriction enzymes to clone into a pENTR Dual Selection vector.

What are the prerequisites for Gateway cloning and expression?

The gene of interest must be flanked by the appropriate att sites, either attL (100 bp) in an Entry clone or attB (25 bp) in a PCR product. For Entry clones, everything between the attL sites will be shuttled into the Gateway destination vector containing attR sites, and a PCR product flanked by attB sites must be shuttled into an attP-containing donor vector such as pDONR221.

The location of translation initiation sites, stop codons, or fusion tags for expression must be considered in your initial cloning design. For example, if your destination vector contains an N-terminal tag but does not have a C-terminal tag, the vector should already contain the appropriate translation start site but the stop codon should be included in your insert.

Will increasing the Gateway cloning reaction time improve recombination efficiency?

Yes, increasing the incubation time from 1 hour to 4 hours will generally increase colony numbers 2-3 fold. An overnight incubation at room temperature will typically increase colony yield by 5-10 fold.

How many times can I thaw BP Clonase II and LR Clonase II?

BP Clonase II and LR Clonase II can be freeze/thawed at least 10 times without significant loss of activity. However, you may still want to aliquot the enzymes to keep freeze/thaw variability to a minimum.

These enzymes are more stable than the original BP and LR Clonase and can be stored at -20 degrees C for 6 months.

How clean must my DNA be to use in a Gateway cloning reaction?

Mini-prep (alkaline lysis) DNA preparations work well in Gateway cloning reactions. It is important that the procedure remove contaminating RNA for accurate quantification. Plasmid DNA purified with our S.N.A.P. nucleic acid purification kits, ChargeSwitch kits, or PureLink kits are recommended.

How would you incorporate a leader sequence for secretion into an entry vector?

A simple way to express a protein with a leader sequence is to have the leader sequence encoded in the destination vector. The other option is to have the leader sequence subcloned into the entry vector using restriction enzymes, or incorporate the leader sequence into the forward PCR primer when cloning a PCR product into the entry vector. Please see Esposito et al. (2005), Prot. Exp. & Purif. 40, 424-428 for an example of how a partial leader sequence for secretion was incorporated into an entry vector.

Where is the ATG relative to the 5' attB site in a Gateway expression clone?

This depends on whether you are expressing a fusion or a native protein in the Gateway destination vector. For an N-terminal fusion protein the ATG will be given by the destination vector and it will be upstream of the attB1 site. For a C-terminal fusion protein or a native protein, the ATG should be provided by your gene of interest, and it will be downstream of the attB1 site.

Are the Gateway attB1 and attB2 sites the same as the attB site used for recombination into E. coli by bacteriophage lambda?

The Gateway attB sites are derived from the bacteriophage lambda site-specific recombination, but are modified to remove stop codons and reduce secondary structure. The core regions have also been modified for specificity (i.e., attB1 will recombine with attP1 but not with attP2).

Will Gateway att sites affect the expression of my protein?

Expression experiments have shown that the extra amino acids contributed by the attB site to a fusion protein will most likely have no effect on protein expression levels or stability. In addition, they do not appear to have any effect on two-hybrid interactions in yeast. However, as is true with the addition of any extra sequences that result from tags, the possible effects will be protein-dependent.

Can the attB primers anneal in a non-specific manner?

No, attB primers are highly specific under standard PCR conditions. We have amplified from RNA (RT-PCR), cDNA libraries, genomic DNA, and plasmid templates without any specificity problems.

What is the smallest fragment that can be used in a Gateway reaction?

The smallest size we have recombined is a 70 bp piece of DNA located between the att sites. Very small pieces are difficult to clone since they negatively influence the topology of the recombination reaction.

Are there any limitations on the insert length in Gateway cloning?

There is no theoretical size limitation. PCR products between 100 bp and 11 Kb have been readily cloned into a pDONR Gateway vector. Other DNA pieces as large as 150 kb with att sites will successfully recombine with a Gateway-compatible vector. Overnight incubation is recommended for large inserts.

What primer purity should be used for adding attB sites to my PCR product?

Standard desalted purity is generally sufficient for creating attB primers. We examined HPLC-purified oligos for Gateway cloning (about 50 bp long) and found only about a 2-fold increase in colony number over standard desalted primers. If too few colonies are obtained, you may try to increase the amount of PCR product used and/or incubate the BP reaction overnight.

Can I sequence a peptide that is acetylated or biotinylated?

No. These groups effectively block the N terminus.