Custom TaqMan™ SNP Genotyping Assay, non-human, L (2400 reactions), made to order - FAQs

View additional product information for Custom TaqMan™ SNP Genotyping Assay, non-human - FAQs (4332076, 4332075, 4332077)

19 product FAQs found

How much gDNA should I use with my TaqMan SNP Genotyping Assay?

We recommend using ~1-20 ng of good-quality gDNA per well. The gDNA should have an A260/A280 ratio of ~1.7-1.9. It is also important to try to add the same amount of gDNA to every well.

How do I submit a sequence for a custom TaqMan SNP Genotyping Assay?

You can use our Custom Assay Design Tool (https://www.thermofisher.com/us/en/home/life-science/pcr/real-time-pcr/real-time-pcr-assays/snp-genotyping-taqman-assays/custom-snp-assays.html?ICID=ta-lm-custom%20taqman%20snp%20assay-Single%20Tube%20Custom%20TaqMan%C2%AE%20SNP%20Genotyping%20Assays) to submit your SNP sequence for an assay design. Alternatively, you can also use Primer Express Software to design an assay. The DNA sequence needs to have at least 30 bases on each side of the SNP site. The more sequence you provide, the greater chance you have of the tool creating a passing design. The ideal sequence length is ~ 200 bases on either side of the SNP site. For the best-performing assay, we recommend prescreening the sequence for other SNPs, repeats, and regions of low complexity. These variations should be masked prior to submitting the sequence. This will prevent the design tool from designing the primers or probe over those regions, which could reduce the efficiency of the assay if they were used. For more details on how to screen and mask the sequence, please follow the guidelines here (https://tools.thermofisher.com/content/sfs/manuals/cms_042307.pdf).

How should I dilute the TaqMan SNP Genotyping Assays?

We recommend diluting the 40X and 80X TaqMan SNP Genotyping Assays to a 20X working stock with 1X TE buffer. The 1X TE buffer should be 10 mM Tris-HCl, 1 mM EDTA, pH 8.0, and be made using DNase-free, sterile-filtered water.

What does the context sequence in the AIF for TaqMan Drug Metabolism Genotyping Assays indicate?

The context sequence indicates the nucleotide sequence surrounding the probe. The SNP is annotated in brackets as follows: [allele 1_VIC labeled/allele 2_FAM labeled]. As an example the context file may look like: CTCCTCTGACACTGTCGCTTCTCCA[T/C]GGCATTAGATTTTCAGTCCTGCTCA. Please note: 25 nucleotides on each side of the SNP site is included in the context sequence. In this example, the SNP [T/C] can be read as T = allele 1 and is VIC dye labeled, C = Allele 2 and is FAM dye labeled. The context sequence of the assay is always shown in the forward orientation, regardless of the strand on which the SNP is typically reported. It is important to compare the context sequence of the SNP assay to the SNP sequence in the NCBI’s dbSNP database to determine which dye is associated with the minor allele.

What do all of the columns mean in the Assay Index File (AIF) that comes with each TaqMan Drug Metabolism Assay?

A detailed description that highlights all columns relevant to the DMEs can be found in the "Understanding Your Shipment Reference Guide" (https://assets.thermofisher.com/TFS-Assets/LSG/manuals/MAN0017153_UnderstandYourShipment_RG.pdf).

My TaqMan Drug Metabolism Genotyping Assay shows some samples clustering with the no template controls. What does this mean?

A sample that clusters with the no template control may indicate that you did not add either DNA or an assay reagent to the reaction well. You may want to redo the experiment. A sample that clusters with the no template control may also indicate the presence of two null alleles in the individual. It is recommended that you repeat the experiment. If the sample again clusters with the no template control, you may want to run a gene dosage assay. All samples that did not amplify in the SNP assay may have a copy number of 0 in the gene dosage assay. Use a positive control to ensure everything else is working.

My TaqMan Drug Metabolism Genotyping Assay cluster plot shows more than three clusters (outliers).  What does this mean?

A cluster plot with more than three clusters may mean that there is an additional SNP under the TaqMan probe or there may be a copy number polymorphism. It is recommended that you perform the assay again to verify the extra cluster. If the extra cluster persists with the same samples, you may want to perform comparative sequencing on the outlier samples to identify if there are any other SNPs present. A persisting extra cluster may also indicate a copy number polymorphism. Homozygous individuals with extra copy numbers of the gene will generally cluster with the homozygous cluster. Only heterozygous individuals tend to fall into a 4 cluster that lies between the heterozygote cluster and one of the homozygous clusters. Therefore, since homozygous copy number variation is somewhat hidden, gene dosage assays should be performed on all samples to determine which individuals carry the extra copies of the gene.

My TaqMan Drug Metabolism Genotyping Assay shows only one cluster. What does this mean?

The presence of a single cluster may indicate that the allele has a very low minor allele frequency (i.e., less than 5% is a rare allele). You should verify the minor allele frequency listed on our website. If there is an allele nomenclature associated with the assay, you may want to refer to the reference paper associated with the polymorphism to determine what population size is needed to see the minor allele. Please note that the minor allele may only occur in certain populations. Visit the article "Interpreting Scatterplots in Genotyping Experiments" in the Real-Time PCR Learning Center (https://www.thermofisher.com/us/en/home/life-science/pcr/real-time-pcr/real-time-pcr-learning-center.html) for more information.

What controls do you recommend running with a TaqMan Drug Metabolism Genotyping Assay?

In addition to using a no template control, we suggest that you use a positive control (sample with a known SNP genotype). This will help you assess the performance of an assay. Unfortunately, we do not offer positive controls for this product line. Visit the Genotyping section of the Real-Time PCR Learning Center (https://www.thermofisher.com/us/en/home/life-science/pcr/real-time-pcr/real-time-pcr-learning-center.html) for tips on how to obtain positive controls for genotyping experiments.

Can I run all of the TaqMan SNP Genotyping Assays using the TaqMan Drug Metabolism Assay thermocycling protocol?

No, the TaqMan Drug Metabolism Assays thermocycling parameters are not optimized to run TaqMan Genotyping Assays. You should use the thermocycling parameters recommended for TaqMan Genotyping Assays.

What do the different numbers after the underscore, at the end of a TaqMan SNP assay ID, mean?

This is an indication of the version. An assay ID with an _30 would mean the third revision of that particular design (i.e. _10 was first version). For some of the DME assays, there is a capital letter with a number after it (i.e. _A0).

Find additional tips, troubleshooting help, and resources within our Gene Expression Analysis & Genotyping Support Center.

How can I reorder a Custom TaqMan Assay that I ordered previously?

To reorder the same Custom TaqMan Assay, you can follow these steps:
- Select an appropriate catalog number, considering the size of the assay that you want. You can find the different catalog numbers for Custom TaqMan Assays on their respective product pages on thermofisher.com.
- Once you have identified the necessary catalog number, go to www.thermofisher.com and click on "Quick Order", in the top right corner of the screen.
- In the following page, paste your selected catalog number in the "Catalog Number" field and paste the assay ID from your previous order in the "Assay ID" field.
- Click "Add to cart" and then in the following screen click "Proceed to check out".

I would like to order a TaqMan SNP Genotyping Assay. Does the kit include everything I need to perform my experiment or do I need to purchase reagents separately?

Each predesigned TaqMan SNP Genotyping Assay is delivered in a single tube consisting of two differentially labeled allele-specific TaqMan MGB (minor groove binding) probes and a pair of PCR primers. For more information, please see the following link: https://www.thermofisher.com/us/en/home/life-science/pcr/real-time-pcr/real-time-pcr-applications/genetic-variation-analysis-using-real-time/snp-genotyping-with-real-time-pcr.html

Besides the TaqMan SNP Genotyping Assay, you would need to purchase a Genotyping Master Mix and nuclease-free water. A list of compatible master mixes can be found in the following link: https://assets.thermofisher.com/TFS-Assets/LSG/manuals/MAN0009593_TaqManSNP_UG.pdf.

Find additional tips, troubleshooting help, and resources within our Gene Expression Analysis & Genotyping Support Center.

Can TaqMan SNP Genotyping Assays be used to quantify allele-specific expression, with cDNA as the template?

No. We do not recommend using TaqMan SNP Genotyping Assays for quantification.

Find additional tips, troubleshooting help, and resources within our Gene Expression Support Center.

Why is the auto calling in the instrument software not working? What can I do?

If you are not getting calls in the instrument software, you can try the free TaqMan Genotyper Software (https://www.thermofisher.com/qpcrsoftware). Another option is the Genotyping App on the Thermofisher Cloud (https://www.thermofisher.com/cloud). These programs have improved algorithms which allow them to make calls that are often missed by the instrument software. In addition, make sure you are running a sufficient number of samples (more than 3), and include at least one NTC well which is labeled in the software.

I have imported experiment files into my study, can I now edit the assay IDs and/or sample IDs in the TaqMan Genotyper Software?

The software does not allow assay IDs or sample IDs to be modified. If a typo occurred or an edit is required, this change must be made in the original experiment file. The software does, however, allow you to create your own assay name and add additional information related to an assay or sample through Setup -->Assays or Setup -->Samples. 

I cannot find a pre-designed assay to my target. Do you have a custom option?

Targets of interest that are not covered by the current Applied Biosystems TaqMan SNP Genotyping collection can be submitted to Custom TaqMan SNP Assay design. 

The Custom TaqMan Assay Design Tool (CADT) is available on www.thermofisher.com. Order a custom TaqMan SNP Genotyping Assay by first entering a sequence with the SNP in brackets, for example [A/G], then submitting the chosen target sites for assay design. Upon notification of successful assay design by email, click the link in the message and add the desired custom assays to your shopping basket. 

CADT can be used to design assays targeting biallelic SNPs or insertion/deletion polymorphisms and multi‐nucleotide polymorphisms (MNPs) that are 6 bases or fewer in length. This tool can also be used to input and order primer and probe sequences of assays that have already been designed that contain FAM or VIC labels and MGB‐NFQ quenchers. 

Note that sequences must be SNP and repeat‐masked before submission to CADT. Additionally, the genome‐uniqueness for assays must first be established, because custom assays are not compared to the genome (e.g., by BLAT or BLASTn) to determine target specificity. Any target on the “unavailable list” (described on page 25) should not be submitted to CADT, because an assay may be designed but it will fail to function properly. For targets that present assay design challenges, contact our fee‐for‐design custom assay design service at custom.solutions@thermofisher.com.

When creating a Real-Time PCR assay for SNP genotyping, could I design it such that the SNP target sequence is included in one of the unlabeled PCR primers rather than in the labeled TaqMan probe?

This is not recommended. For best sensitivity in discriminating between alleles in endpoint analysis, the target polymorphism sequence should appear within the differentially-labeled probes. In our pre-designed TaqMan Assays for SNP Genotyping, the single nucleotide polymorphism is generally located within the middle-third of the TaqMan probe sequence.

When designing probes to perform Allelic Discrimination (SNP assays), are there any alternatives to using probes longer than 30bp in order to get the appropriate melting temperature?

Applied Biosystems TaqMan MGB (minor groove binder) probes would be appropriate for Allelic Discrimination/SNP Genotyping probe designs. TaqMan MGB probes have a minor groove binder at the end of the probe. This minor groove binder increases the Tm of probes, allowing the use of shorter probes. Consequently, the TaqMan MGB probes exhibit greater differences in Tm values between matched and mismatched probes, which provides more accurate allele discrimination.

For information on the design of TaqMan MGB probes for Allelic Discrimination/SNP assays using Primer Express software, please refer to our guide "Designing TaqMan MGB Probe and Primer Sets for Allelic Discrimination Assays Using Primer Express".