TaqMan™ Copy Number Reference Assay, human, TERT, 3,000 reactions - FAQs

TaqMan™ Copy Number Reference Assay, human, TERT, 3,000 reactions - FAQs

View additional product information for TaqMan™ Copy Number Reference Assay, human, TERT - FAQs (4403315, 4403316)

46 product FAQs found

Can I use the CopyCaller Software if I am using a non-Applied Biosystems Real-Time PCR instrument?

Yes, although the data will not be directly compatible. You can use the example files that install with the CopyCaller Software as a template to use with your data. You will have to copy/paste in the sample/target names and Ct values before importing into CopyCaller Software.

My data will not import into the CopyCaller Software. What could be wrong?

In the instrument software, make sure that you selected “Results” from the export options. The data need to be set up as duplex reactions as well. If you ran the copy number assay and the reference assay in separate wells, the data will not be in the correct format.

CopyCaller Software gave the error "XXX.txt is not a compatible file and cannot be added to the analysis. Verify that the file format is compatible with the software." What can I do now?

Check your export results with the instrument software. The data columns need to be in the following order: Well, Sample Name, Target Name, Task Reporter, Quencher, CT. If needed, rearrange the columns and export the data again for CopyCaller Software.

My results are different from what I expected when working with your Copy Number Variation Assay. Is there something wrong with the assay?

Check that the reference assay is performing consistently across all samples. Check the concentration of your samples and make sure they are normalized. We also recommend you to use several copy number assays targeting the same variation to validate the data.

What can I do if the copy number confidence values are very low?

Confidence values can be low for several reasons. Check your data for the following:

- Large variability in ΔCt values across the plate.
- Low number of replicates per sample (recommendation is for at least 4 replicates per sample).
- Sample copy number is high (> 3). You may want to use copy number bins instead for high copy numbers. Also keep in mind that CopyCaller Software is best for copy ranges of 1-5. If you have higher copy numbers, such as with transfections/transductions, it is best to use a standard curve.

What can I do if the reference assay Ct values vary during copy number analysis?

Check your pipettes for accuracy. Check the concentration of your samples and make sure they are normalized. Another possibility is that the chromosome on which the reference gene is located is disrupted in the samples you are working with. In this case, try a different reference assay.

When trying to open CopyCaller Software, the program freezes after launch and will not open. What can I do?

In this case, you may see the blue CopyCaller Software screen pop up, but it will never advance beyond this screen to actually open the software. If this occurs, try the following:

- Press Control+Alt+Delete to bring up the Task Manager.
- Select the “Processes” tab, and look for a process called “javaw.exe”. End this process and then relaunch the CopyCaller Software.

What should I do when I get the CopyCaller Software error "Insufficient data points to estimate confidence and z-score values"?

This message will appear if you don't have at least 7 samples in a given copy number group. You can continue with the analysis, but just be aware that you will not get any statistics with your data.

How much genomic DNA do I need to use with the TaqMan Copy Number Assays?

The recommend input is ~20 ng of genomic DNA. Make sure the gDNA is accurately quantitated, and to use the same amount for each sample run with the same assay.

Can the TaqMan Copy Number Assays be run using a Fast protocol?

The TaqMan Copy Number Assays have not been validated with a Fast protocol. Preliminary studies have shown that Fast protocol analysis is not reliable for copy number quantitation analysis.

Can I run the TaqMan Copy Number Assays in singleplex?

The TaqMan Copy Number Assays must be run in duplex for good quantitation results. Inclusion of the reference assay in the same reaction as the copy number assay normalizes for the amount of DNA in that particular replicate well. The CopyCaller Software cannot analyze data from a plate running singleplex assays.

I am working with a species other than human and mouse. What reference assay can I use for copy number analysis?

First, you would need to select a reference sequence: usually a well studied gene, known to be present in 2 copies per diploid and found in a non-copy-number variant region of the genome. Next you can use Primer Express software to generate a VIC/TAMRA probe-based assay from the sequence. The primers and probe sequences can be ordered online. A 20X stock reference assay should be made that contains 18 µM each primer and 5 µM probe. The reference assay should be tested on a number of samples (4 replicates each) to determine its performance before using it in duplex with CN assays.

Which reference assay should I use for copy number analysis with human samples?

We offer two reference assays for human samples: RNase P and TERT. The RNase P assay is the recommended first choice, with TERT being offered in the event that a chromosomal aberration in a sample results in suboptimal RNase P assay functionality. RNase P is located on chromosome 14, cytoband 14q11.2. The assay location is chr.14:20811565 on NCBI build 37. It has an 87 bp amplicon that maps within the single-exon RPPH1 gene. The TERT assay targets the telomerase reverse transcriptase (TERT) gene located on chromosome 5, cytoband 5p15.33. The assay location is chr.5:1253373 on NCBI build 37. It has an 88 bp amplicon that maps within exon 16 of the TERT gene.

What experiment type should I choose in the real-time instrument software for Copy Number Assays?

In your instrument software, choose “Absolute Quantitation” or “Quantitation - Standard Curve” from the experimental properties. For analysis, we recommend to use an automatic baseline and a manual threshold of 0.2.

What master mix can I use with the Copy Number assays?

TaqMan Genotyping Master Mix is the recommended master mix for use with TaqMan Copy Number Assays. TaqMan Gene Expression or TaqMan Universal Master Mixes can also be used.

How many replicates should I run in my TaqMan Copy Number Assay?

We recommend that you to run 4 replicates per sample for reliable copy number calls.

Can I use the TaqMan Copy Number assays to determine high-copy insertions?

Our copy number analysis by ddCT is best for up to 5 copies. This is because as you get to higher copy numbers, the fold change between copies gets smaller and smaller. For copy numbers above 5, it is best to use another method such as digital PCR or standard curve analysis.

How do I find a calibrator sample for my qPCR experiment? Is it necessary for my experiment?

We recommend that you check the DGV (database of genomic variants) database for your CNV of interest. Not all regions of variance have control samples available, but if there are controls for your CNV, the DGV will list some Coriell sample IDs. You can then order these control samples from Coriell.

Can I use the TaqMan Copy Number assays for transgenic experiments?

Yes, we have several assays designed to common reporters used in transgenic studies such as Cre, EGFP, and more. You can find the full list here - https://www.thermofisher.com/order/genome-database/searchResults?searchMode=keyword&CID=&productTypeSelect=cnv&alternateProductTypeSelect=&originalCount=&alternateTargetTypeSelect=&targetTypeSelect=cnv_mr&otherSpecies=&selectedInputType=&keyword=&sequen.

How do I analyze my copy number data?

We recommend you to use our free CopyCaller Software. The CopyCaller Software was developed specifically for TaqMan Copy Number Assay data analysis. This free, easy-to use software utilizes a graphical interface and quickly calculates the possible copy numbers for a set of samples in a run. It also estimates a confidence value for each copy number call and has outlier removal functionality.

Can I use TaqMan Gene Expression Assays for a gene copy number study?

TaqMan Gene Expression Assays with “_s1” as assay ID suffix are the assays whose primers and probes are designed within a single exon, and therefore, will detect genomic DNA. However, the application of these assays in gene copy number studies has not been validated. Other gene expression assays will not detect gDNA, let alone the region of variance.

What type of samples should be run with TaqMan Copy Number Assays?

These assays target regions of variance that are found in genomic DNA.

Do I need to do a validation test before I use the ΔΔCt method to determine the copy number of the target gene?

If you are using our copy number assays and reference assays, this is not necessary.

Where can I get reference samples for TaqMan Copy Number Assays?

We recommend that you check the DGV (database of genomic variants) database for your CNV of interest. Not all regions of variance have control samples available, but if there are controls for your CNV, the DGV will list some Coriell sample ids. You can then order these control samples from Coriell.

What endogenous control is recommended for TaqMan Copy Number Assays?

We recommend that you run one of our TaqMan Copy Number Reference assays in duplex with your target copy number assay. In human, we offer Rnase P and TERT copy number reference assays; in mouse, we offer Tfrc and TERT copy number reference assays. The reference assays are VIC-TAMRA labeled so that they can be run in duplex with your target copy number assay of interest.

What TaqMan Copy Number Assays are available now?

We have predesigned TaqMan Copy number assays for human and mouse, and we also have the Geneassist Copy number assay workflow builder tool that you may use to submit sequences for custom designed assays. Copy number variation experiments require a reference assay run in duplex with the target assay. We offer RNase P and TERT reference assays for human, and we offer Tfrc and TERT reference assays for mouse. The copy number assays are FAM-MGB labeled and the copy number reference assays are VIC-TAMRA labeled.

Does the TaqMan Copy Number Reference Assay, human, TERT (Cat. No. 4403316, 4403315) work for Rhesus?

The human TERT assay cannot detect Rhesus; only one of the primers of this assay matches; the other primer and probe show significant mismatch.

Find additional tips, troubleshooting help, and resources within our Real-Time PCR and Digital PCR Applications Support Center.

What is the concentration and sequence for my TaqMan Copy Number Reference Assay?

The TaqMan Copy Number Reference Assays have a concentration of 20x. Each reference assay contains a probe at 5 µM and primers at 18 µM concentration. The sequence is proprietary. However, the sequence for the padded amplicon is the following:
  • CN reference assay human RNase P (Cat. No. 4403326, 4403328) control amplicon: GTTCTGTATGAGACCACTTTTTCCCATAGGGCGGAGGGAAGCTCATCAGTGGGGCCACGAGCTGAGTGCGTCCTGTCACTCCACTCCCATGTCCCTTGGGAAGGTCTGAGACTAGGGCCAGAGGCGGCCCTAACAGGGCTCTCCCTGAGC
  • CN reference assay human TERT (Cat. No. 4403316, 4403315) control amplicon: GTATTTTACTCCCACAGCACCTCCCCCCAATTTGACCCACAGGGACCCCCATCCAGGTGCAGGGTCCTCGCCTGTGTACAGGGCACACCTTTGGTCACTCCAAATTCCCAGAGCTCCCAGGGTCCTTCTCAGGGTCTCCACCTGGATGGT
  • Mouse Tfrc ref (Cat. No. 4458366, 4458367) control sequence (padded amplicon): GATACCTATGAGGCATTGACTCAGAAAGTTCCTCAGCTCAACCAAATGGTTCGTACAGCAGCGGAAGTGGCTGGTCAGCTCATTATTAAACTTACCCATGACGTTGAATTGAACCTGGACTATGAGATGTATAACAGCAAACTACTGTCA
  • Mouse Tert ref (Cat. No. 4458368, 4458369) control sequence (padded amplicon): CAAATGTGAGGGGTGCCTGGGTGACCTCCTTGTCCTGACCATCTGGTGACACCCACCCCTGCCAGCACCTGCGTGTCTGCACCTGCATGTATGTTTGGTTCCATTGTGTTCTCTGAGAAGGCACTCACTTTTTTCACACGGCTGTCACCA


Find additional tips, troubleshooting help, and resources within our Real-Time PCR and Digital PCR Applications Support Center.

What is the sequence and concentration for the TaqMan Copy Number Reference Assay, human, TERT (Cat. No. 4403315)?

The sequence is proprietary. However, the sequence for the padded amplicon is the following: GTATTTTACTCCCACAGCACCTCCCCCCAATTTGACCCACAGGGACCCCCATCCAGGTGCAGGGTCCTCGCCTGTGTACAGGGCACACCTTTGGTCACTCCAAATTCCCAGAGCTCCCAGGGTCCTTCTCAGGGTCTCCACCTGGATGGT. The assay contains 5 µM probe and 18 µM primers .

Find additional tips, troubleshooting help, and resources within our TaqMan Primers and Probes Support Center.

Why do the values for the reference assay dye (VIC dye) vary for my TaqMan Copy Number Assay?

Please review the following possible causes and solutions:
-The reference sequence is not present or contains polymorphisms in the gDNA sample. Use an alternate copy number reference assay.
- There is variability in the amount of gDNA sample added to each reaction. Quantify the gDNA, then adjust the concentration of gDNA as needed.
Note: In general, the calculation of sample-level ΔCt accounts for variability in sample concentration.
- Pipetting was inaccurate. Check the pipette calibration of the pipettes, and pipette at least 5 µL of sample to prepare the reaction mix.

Why is the multicomponent signal for ROX dye not flat for my TaqMan Copy Number Assay?

Most likely incorrect dyes were selected for each target. Check the dyes selected for each target, then reanalyze the data.

Why was there a simultaneous increase in fluorescence from both the passive reference dye (ROX dye) and the reporter dyes for my TaqMan Copy Number Assay?

Most likely the sample evaporated. We recommend that you check the seal of the adhesive film for leaks before running the plate on the real-time PCR instrument.

Why was there a decrease in ROX dye fluorescence (passive reference dye) in my TaqMan Copy Number Assay?

Please review the following possible causes and solutions:
- There was insufficient Master Mix added to the reaction. Please follow accurate pipetting practices.
- Reagents are degraded. Ensure that the kits and reagents have been stored according to the instructions on the packaging and that they have not expired.

Why is there is a noisy signal above the threshold for my TaqMan Copy Number Assay?

Please review the following possible causes and solutions:
-The sample evaporated. Check the seal of the adhesive film for leaks.
- The well is empty because of inaccurate pipetting. Check the calibration of the pipettes, and pipette at least 5 µL of sample.
- The well is assigned a sample or target in the plate document or experiment, but the well is empty. Ensure that the plate document or experiment is set up correctly. Then try excluding the well and reanalyzing the data.

Why are the results for my TaqMan Copy Number Assay inconsistent (high standard deviation in the replicates, inconsistent data, or a variable Ct)?

Please review the following possible causes and solutions:
- The reagents were not mixed properly. Increase the length of time that you mix the reagents. We recommend that you confirm your mixing process by running a replicate assay.
- Pipetting was inaccurate. We recommend that you check the pipette calibration, and pipet at least 5 µL of sample to prepare the reaction mix.
- The threshold was not set correctly. Set the threshold above the noise level and where the replicates are tightest. See your real‑time PCR system user documentation for more information about setting the threshold.
-The concentration of one or more reaction components was incorrect. Ensure that the correct amounts of all the reactions components were added to the reaction plate.
- There was a low concentration of the target of interest. Rerun the assay with more gDNA template.
- Too much gDNA was added. We recommend that you reduce the amound of gDNA template added to the reaction mixture.
- The gDNA template or the amplicon is contaminated. Re-extract the gDNA and repeat the assay. Follow established PCR good laboratory practices to prevent contamination.

Why is there amplification in the negative control well for my TaqMan Copy Number Assay?

Please review the following possible causes and solutions:
- The reagents are contaminated with gDNA, amplicon or plasimd clones. We recommend that you esnure that your workspacea dn equpiment are cleaned correctly, then rerun the assay using new reagents. We also rsuggest that you use a Master Mix that contains UNG, such as TaqPath ProAmp Master Mix.
- The template or amplicon is contaminated. Please follow established PCR good laboratory practices to prevent contamination.

Why does the amplification curve show no amplification of the sample (Ct=40) in the target TaqMan Copy Number Assay?

Please review the following possible causes and solutions:
- The copy number sequence is not present in the sample. First, run a sample with a known copy number for the target genomic region. Ensure that the Ct values for the reference assay (VIC dye) are normal in the samples without the copy number assay (FAM dye) signal. You can confirm your results by rerunning the sample using the same assay and/or running the sample using an alternative assay in the same genomic region, if available.

- There is a mismatch between the assay and the target sequence. We recommend that you perform bioinformatics for custom assays.
For example, ensure that the sequence submitted to assay design contains the correct target sequence. If needed, select an alternative target region for assay design or select another assay from the same genomic region. We also recommend using Custom Plus assays, which include bioinformatics.

- One or more of the PCR reaction components was not added. Check your pipetting equipment and/or technique.

- Incorrect dyes were selected for each target. Check the dyes selected for each target, then reanalyze the data.

- The annealing temperature was too high for the primers and/or probes. Ensure that the thermal cycler is set to the correct annealing and extension temperatures.
- The template is degraded. Determine the quality of the template, then rerun the assay with a fresh template if needed. We recommend that you use nuclease-free water.

- Inhibitors are present in the reaction. To check for inhibitors, we recommend that you run a serial dilution of your sample with an assay known to detect a tarfet in the sample (e.g. a reference assay). If an inhibitor is present, the high concentration samples yield higher-than-expected Ct values because the sample are not diluted.

- The baseline and/or threshold was improperly set. See your real-time PCR system user guide for procedures on setting the baseline and threshold. We recommend switching from an automatic baseline to a manual baseline (or vice versa), and/or lowering the threshold value to fall within the appropriate range.

Why are the amplification curves shaped differently for different samples with the same TaqMan Copy Number Assay?

Please review the following possible causes and solutions:
- The baseline was set improperly. We recommend switching from an automatic baseline to a manual baseline (or vice versa), and/or increasing the upper or lower value of the baseline range.
Please see your real‑time PCR system user guide for procedures on setting the baseline.
- The gDNA quality was poor. We recommend that you perform a quality check on the gDNA, then re-extract the gDNA if needed.
- There were difference concentrations caused my imprecise pipetting. Please follow accurate pipetting practices.
- The reagents or equipment are contaminated. Please ensure that your workspace and equipment are cleaned properly.

Why does the amplification curve show weak amplification for the samples in my TaqMan Copy Number Assay?

Please review the following possible causes and solutions:
- There is a sequence mismatch between the target region and the copy number assays. We recommend that you perform bioinformatics analysis, or select another assy from the same genomic region, if available.
- The reagents or the assays are degraded. Ensure that the kits and reagents have been stored according to the instructions on the packaging and that they have not expired. We recommend that you dilute the 60x assay to a 20x working stock to avoid excessive freeze-thaw cycles.
- The gDNA template is degraded or contaminated. Follow established PCR good laboratory practices.
- Inhibitors are present in the reaction. To confirm the presence of an inhibitor, we recommend that you run a serial dilution of your sample with an assay known to detect a target in the sample (e.g. a reference assay). If an inhibitor is present, low concentrations yield higher-than-expected Ct values because the sample is not diluted.

Why does the amplification curve show a rising baseline for samples in my TaqMan Copy Number Assay?

There may be interaction between the primer and probe. We recommend that you adjust the threshold manually, or select another assay from the same gene, if available. Alternatively, there may be bubbles in a well. In this case, we recommend that you repeat the assay with new reagents and centrifuge the reaction plate to ensure that it does not contain bubbles.

Why does the amplification curve show an abnormal plot and/or low ΔRn values for samples in my TaqMan Copy Number Assay?

Please review the following possible causes and solutions:
- The baseline was set too high and some samples have Ct values lower than the baseline stop value. We recommend that you switch from manual to automatic baselining, or move the baseline stop value to a lower Ct. The baseline stop value should be set to a Ct 2 cycles before the amplification curve crosses the threshold. See your real‑time PCR system user guide for procedures on setting the baseline.
-No baseline can be set because the amplification signal is detected too early in the PCR cycles. We recommend that you use a gDNA concentration within the recommended range, and dilute the sample to increase the Ct value if needed.

There was a small ΔRn for samples in my TaqMan Copy Number Assay?

A small ΔRn can mean that the PCR efficiency was poor. Ensure that the reagents were used at the correct concentration. Alternatively, the quantity of gDNA may be low (a low copy number of the target). In this case, we recommend that you increase the quantity of the gDNA in the reaction.

Why did the Rn value shift during the early PCR cycles (cycles 0 to 5) for my TaqMan Copy Number Assay?

Most likely the fluorescence did not stabilize to the buffer conditions of the reaction mix.
Note: This condition does not affect PCR or the final results.
We recommend that you reset the lower value of the baseline range or use an automatic baseline.

Why is the Rn in the Rn vs. Cycle plot so high for my TaqMan Copy Number Assay?

Most likely the ROX dye was not set as the passive reference. Set ROX dye as the passive reference, then reanalyze the data.

Why does the amplification plot show a high level of noise for my TaqMan Copy Number Assay?

Most likely the incorrect dye is set as the passive reference. Change the passive reference to the correct dye, then reanlyze the data.

Why do the amplification curves for samples appear as sigmoidal curves with my TaqMan Copy Number Assay?

When automatic baseline is used, the software selects baseline cycle values that are too narrow.
We recommend that you try the following:
-Change the analysis setting to allow manual adjustment, then set the Baseline Start Cycle to 3 and the Baseline End Cycle to 15.
- Set the Amplification Plot's graph type to linear. If amplification appears to begin earlier than cycle 15, adjust the Baseline End Cycle to 2 cycles prior to the start of amplification.
For example, if the amplification appears to begin at cycle 13, set the Start Cycle to 3 and End Cycle to 11.