ARN polymérase T7, HC (200 U/μl)
Thermo Scientific™

ARN polymérase T7, HC (200 U/μl)

L’ARN polymérase du bactériophage T7 Thermo Scientific est une ARN polymérase ADN-dépendante avec une spécificité stricte pour leurs promoteurs doubleAfficher plus
Have Questions?
RéférenceQuantité
EP011325 000 U
Référence EP0113
Prix (EUR)
168,65
Offre exceptionnelle en ligne
196,00
Économisez 27,35 (14%)
Each
Quantité:
25 000 U
Grand volume ou format personnalisé
Prix (EUR)
168,65
Offre exceptionnelle en ligne
196,00
Économisez 27,35 (14%)
Each
L’ARN polymérase du bactériophage T7 Thermo Scientific est une ARN polymérase ADN-dépendante avec une spécificité stricte pour leurs promoteurs double brin respectifs. Elle catalyse la synthèse 5’→3’ de l’ARN sur l’ADN simple brin ou l’ADN double brin en aval de son promoteur.

Mises en évidence

• Incorpore des nucléotides modifiés (par exemple des nucléotides marqués à l’amino-allyle, la biotine, la fluorescéine, la digoxigénine)

Applications

Synthèse d’ARN non marqué et marqué qui peut être utilisée :

• Pour l’hybridation, la translation in vitro de l’ARN
• Comme aARN, siARN, substrat dans les dosages de protection RNase, modèle pour le séquençage de l’ADN génomique
• Dans les études de la structure secondaire de l’ARN et des interactions ARN-protéines, épissage de l’ARN

Séquence du promoteur consensuelle :
T7 : TAATACGACTCACTATAGGGAGA
Usage exclusivement réservé à la recherche. Ne pas utiliser pour des procédures de diagnostic.
Spécifications
Concentration> 200 U/µl
Quantité25 000 U
PolyméraseARN polymérase T7
Unit SizeEach

Foire aux questions (FAQ)

What is the advantage of using TranscriptAid T7 High Yield Transcription Kit over Thermo Scientific T7 RNA Polymerase with a standard transcription buffer?

TranscriptAid T7 High Yield Transcription Kit is designed to produce both long and short transcripts for applications that require large yields of RNA (milligram amounts). The kit can achieve 10 times greater amount than from conventional in vitro transcription reactions with T7 RNA polymerase due to its unique proprietary enzyme and buffer formulations. Please note that TranscriptAid T7 High Yield Transcription Kit is not recommended for generation of radioactively labelled RNA. Due to large quantities of RNA synthesized with the kit, generation of high specific activity radiolabeled probes would require prohibitively large amounts of radiolabeled nucleotide.