Informational:Access to customized raw materials for producing RNA vaccines and therapeutics. Inquire about available services.
Thermo Scientific™

TheraPure™ GMP T7 RNA Polymerase, 200 U/μL

Catalog number: EP011SKB003
Thermo Scientific™

TheraPure™ GMP T7 RNA Polymerase, 200 U/μL

Catalog number: EP011SKB003
Catalog Number
EP011SKB003
Unit Size
1000 kU
Price (USD)
Catalog Number
Unit Size
200 kU
Price (USD)
Catalog Number
Unit Size
2000 kU
Price (USD)
Catalog Number
Unit Size
5000 kU
Price (USD)
Catalog Number
Unit Size
40000 kU
Price (USD)
Catalog NumberUnit SizePrice (USD)
EP011SKB0031000 kURequest A Quote
EP011SKB008200 kURequest A Quote
EP011SKB0112000 kURequest A Quote
EP011SKB0045000 kURequest A Quote
EP011SKB00640000 kURequest A Quote
Product Overview
Figures
Videos
Recommendations
Recommendations
Documents
FAQ
Citations & References
Additional Information
Recommendations

Thermo Scientific TheraPure GMP* T7 RNA Polymerase is manufactured to ICH Q7 GMP principles and supported by comprehensive documentation package. It is designed for synthesis of mRNA in the development and manufacturing of mRNA therapeutics and vaccines. As an DNA-dependent RNA polymerase, it synthesizes RNA 5'→3' from linear DNA containing the T7 promoter (TAATACGACTCACTATAGGGAGA).

Designed for process development and manufacturing
TheraPure GMP T7 RNA Polymerase helps accelerate mRNA vaccine and therapeutics production from preclinical development to commercialization by providing:
Quality—meet critical product quality needs to help accelerate therapeutic development and manufacturing
Minimal risk—help reduce risks in developing therapeutics by utilizing proven products
Technical partnership—partner with expert product and technical support
Secure and consistent supply—count on a secure and stable supply of product at a global scale

Comprehensive quality system
TheraPure GMP T7 RNA Polymerase is supported by a extensive quality system and documentation including:
• Manufactured to relevant ICH Q7 GMP guidelines
• Animal-origin free (AOF) manufacturing processes, materials, and facilities
• Validated manufacturing processes and analytical test methods
• Comprehensive impurity profiles
• Verified compendial assays where applicable
• Product stability data
• Tested by analytical methods following ICH Q2 guidelines whenever possible
• Drug master file (DMF)

Enzyme activity
One unit of enzyme incorporates 1 nmol of AMP into a polynucleotide fraction in 60 minutes at 37°C.

For additional TheraPure GMP products or customization, please visit www.thermofisher.com/therapure.

*TheraPure GMP refers to the quality level of the raw, ancillary, or starting materials to be used for further manufacturing. TheraPure GMP products are manufactured in facilities with ISO 9001–certified quality management systems that operate in accordance with relevant good manufacturing practice (GMP) principles, as outlined in ICH Q7 or equivalent guidance documents or standards.

For Research Use or Further Manufacturing. Not for diagnostic use or direct administration into humans or animals.

Specifications

Final Product Type
Liquid
Polymerase
T7 RNA Polymerase
Product Line
TheraPure™ GMP
Promoter
T7
For Use With (Application)
IVT Transcription, RNA synthesis, mRNA synthesis
Quantity
1000 kU
Concentration
200 U/μL
Storage Buffer
25 mM HEPES-NaOH, pH 7.6, 0.1 mM EDTA-Na2, 150 mM NaCl, 10 mM DTT, 0.09% Triton X-100, 50% glycerol
Expression System
E. coli
Mass
99 kDa
Source
Bacteriophage T7
pH Range
7.2 to 8.0
Appearance
Transparent
Percent Purity
≥95

Contents & Storage

Store at -20 ± 5°C.

Figures

Documents & Downloads

Certificates

    Frequently asked questions (FAQs)

    Citations & References

    Search citations by name, author, journal title or abstract text