Search
Search
View additional product information for GeneRacer™ Kit with AMV RT and TOPO TA Cloning™ Kit for Sequencing - FAQs (L150001)
17 product FAQs found
The GeneRacer method is designed to ensure that only full-length messages are ligated to the GeneRacer RNA Oligo and PCR amplified after cDNA synthesis. It is highly recommended that you clone your RACE products and analyze at least 10-12 colonies to ensure that you isolate the longest message. Many genes do not have only one set of transcription start sites but rather multiple transcription start sites spanning sometimes just a few or other times a hundred or even more bases. Cloning of the RACE products and analyzing multiple colonies ensues that you detect the diversity of the heterogeneous transcription start sites of your gene. It is also possible that you might obtain PCR products that may not represent the full-length message for your gene. PCR products that do not represent full-length message may be obtained because:
-RNA degradation after the CIP reaction creates new truncated substrates with a 5' phosphate for ligation to the GeneRacer RNA Oligo. Be sure to take precautions to ensure that the RNA is not degraded.
-CIP dephosphorylation was incomplete. Increase the amount of CIP in the reaction or decrease the amount of RNA.
-PCR yielded a PCR artifact and not true ligation product. Optimize your PCR using the suggestions described above.
RACE PCR artifacts or nonspecific PCR bands can result from one or more of the following:
-Nonspecific binding of GSPs to other cDNAs resulting in the amplification of unrelated products as well as desired products.
-Nonspecific binding of GeneRacer primers to cDNA resulting in PCR products with GeneRacer primer sequence on both ends of the PCR product.
-RNA degradation.
-Contamination of PCR tubes or reagents.
Note: Artifacts usually result from less than optimal PCR conditions and can be identified in negative control PCR.
Please see the following causes and suggestions:
Contamination by genomic DNA or an unexpected splice variant - Pretreat RNA with DNase I, amplification grade (Cat. No 18068015).
Design primers that anneal to sequences in exons on both sides of an intron or at the exon/exon boundary of the mRNA to differentiate between amplified cDNA and potential contaminating genomic DNA.
To test if products were derived from DNA, perform a minus RT control.
Nonspecific annealing of primers - Vary the PCR annealing conditions.
Use a hot-start PCR polymerase.
Optimize magnesium concentration for each template and primer combination.
Primers formed dimers - Design primers without complementary sequences at the 3' ends.
Please see the following causes and suggestions:
Procedural error in first-strand cDNA synthesis - Use high-quality RNA as a control to verify the efficiency of the first-strand reaction.
RNase contamination - Add control RNA to sample to determine if RNase is present in the first-strand reaction. Use an RNase inhibitor in the first-strand reaction.
Polysaccharide co-precipitation of RNA - Precipitate RNA with lithium chloride to remove polysaccharides, as described in Sambrook et al.
Target mRNA contains strong transcriptional pauses - Use random hexamers instead of oligo(dT) in the first-strand reaction, increase the temperature, and use PCR primers closer to the 3' terminus of the target cDNA.
Too little first-strand product was used in PCR - Use up to 10% of first-strand reaction per 50 mL PCR.
Gene-specific primer was used for first-strand synthesis - Try another set of GSP or switch to oligo(dT). Make sure the GSP is the antisense of the sequence.
Inhibitors of RT present - Remove inhibitors by ethanol precipitation of mRNA preparation before the first-strand reaction. Include a 70% (v/v) ethanol wash of the mRNA pellet. Note: inhibitors of RT include SDS, EDTA, guanidinium salts, formamide, sodium pyrophosphate, and spermidine.
RNA has been damaged or degraded - Ensure that high-quality, intact RNA is being used.
Annealing temperature is too high - Decrease temperature as necessary and/or use touchdown PCR.
3' RACE takes advantage of the natural poly(A) tail found in mRNA as a generic priming site for PCR. In this procedure, mRNAs are converted into cDNA using reverse transcriptase (RT) and an oligo-dT adapter primer. Specific cDNA is then amplified by PCR using a gene-specific primer (GSP) that anneals to a region of known exon sequences and an adapter primer that targets the poly(A) tail region. This permits the capture of unknown 3'-mRNA sequences that lie between the exon and the poly(A) tail.
Here are our suggestions to optimize your RACE reaction:
-Use high-quality, intact RNA
-Use an RNA sample in which your gene is expressed at high levels
-Do not exceed the recommended amount of input material in each step
-Optimize annealing temperatures for PCR
-Include recommended controls
Alternative splicing, an alternative polyadenylation site, and alternative start sites can yield legitimate multiple bands. Sequencing will help to resolve any uncertainty.
If the reaction gives a specific product and the control reaction does not, your band is probably real. The only way to be sure is to sequence the product.
If you are performing either 5' or 3' RACE, you will need one gene-specific primer and if you are performing both 5' and 3' RACE, you would need two gene-specific primers. The primers should follow the rules stated below:
-50-70% GC content to obtain a high annealing temp (>72 degrees C)
-23-28 nucleotides in length to increase specificity of binding
-Low-GC content at 3' ends to minimize extension by DNA polymerase at non-target sites (no more than two G or C residues in the last five bases)
-No self-complementary sequences within the primer or no sequence complementary to the primers supplied in the kit, especially at the 3' end
-Annealing temperature greater than 72 degrees C—using primers with a high annealing temperature will help to improve specificity of your PCR
To check the RNA for integrity, analyze 500 ng of your RNA by agarose/ethidium bromide gel electrophoresis. You may use a regular 1% agarose gel or a denaturing agarose gel. For total RNA you should see the 28S and 18S rRNA bands. mRNA will appear as a smear from 0.5 to 12 kb. The 28S band should be twice the intensity of the 18S band. If you do not load enough RNA, the 28S band may appear to be diffuse. If you are using a denaturing gel, the rRNA bands should appear very clear and sharp. The 28S band should run at 4.5 kb and the 18S band should run at 1.9 kb.
RACE stands for Rapid Amplification of cDNA Ends. It is a method used to discover the 5' and/or 3' end of full-length transcripts. If partial sequence is known for a transcript of interest, RACE can help to elucidate the full ORF, 5' UTR, and 3' UTR sequences.
Several factors are important for the best results.
(1) The key factor for success is the quality of the RNA. RNA degradation is the most likely reason for failure to obtain a correct RACE product. We strongly recommend that you analyze a sample of your RNA on an agarose gel before starting to confirm RNA integrity. The use of RNaseOUT RNase inhibitor ensures RNA stability during various enzymatic reactions. If you are concerned about RNA stability, you may check the stability of the RNA after each enzymatic reaction (CIP, TAP, and ligation reaction) using agarose gel electrophoresis. Resuspend the RNA in DEPC water after enzymatic treatment in an appropriate volume (see pages 7, 9 and 11 of GeneRacer kit manual) and check 1 µL on an agarose gel. Compare with the same amount of untreated RNA to check for degradation.
(2) RACE PCR artifacts or non-specific PCR bands can result from one or more of the following:
-Non-specific binding of GSPs to other cDNAs resulting in the amplification of unrelated products as well as desired products.
-Non-specific binding of GeneRacer primers to cDNA resulting in PCR products with GeneRacer primer sequence on one end.
-RNA degradation.
-Contamination of PCR tubes or reagents.
Note: Artifacts usually result from less-than-optimal PCR conditions and can be identified in negative control PCR.
(3) If a smear in GeneRacer 5' primer negative control is visible, then we recommend the following:
-Use a different 5' primer, called the GeneRacer 5' primer. It is homologous to the slightly different site at the RNA oligo but it generally gives less background compared to the original 5' primer. Here is the sequence of the GeneRacer 5' primer:
5' GCACGAGGACACTGACATGGACTGA
This primer can be synthesized and used in the 5' RACE PCR instead of the original 5' primer. It should reduce the background in RACE PCR.
(4) If you see smears when performing the negative control using 5' primer, the other negative controls (no template, GSP with template) were fine, and all reactions had the same PCR conditions, then:
-If there is background when using the 5' primer and template than you should subtract those bands/smear from the actual RACE reaction discarding it so that not to confuse with the real RACE bands. The smear in that negative control will always be there because every cDNA has the binding site for that primer. So there should not be any major concern about the smear. If the actual RACE PCR works then the RACE band would outweigh the smear background.
For the Directional TOPO Cloning Vectors, a PCR product must be generated by a proofreading enzyme to create a blunt product. Pfx50 or Accuprime Pfx and Accuprime Pfx Supermix from Thermo Fisher Scientific are recommended for use.
When cloning a Pfx-amplified PCR product, the insert to vector ratio is an important consideration. The PCR product generally needs to be diluted since Pfx generates a high concentration of product and using too much insert DNA can hamper the TOPO reaction. A 1:1 molar ratio of vector to insert (or about 2-10ng of insert) is recommended.
If you wish to use a polymerase mixture containing Taq polymerase and a proofreading polymerase, Taq must be used in excess with a 10:1 ratio of Taq to the proofreading enzyme to ensure the presence of 3´ A-overhangs on the PCR product. If you use polymerase mixtures that do not have enough Taq polymerase or a proofreading polymerase only, you can add 3' A-overhangs following PCR. See the vector product manuals for details.
Some examples of Taq blends that are compatible with TOPO TA Cloning are Platinum Taq DNA Polymerase High Fidelity and AccuPrime Taq DNA Polymerase High Fidelity.
Taq polymerase has a non-template-dependent terminal transferase activity that adds a single deoxyadenosine (A) to the 3´ ends of PCR products. The linearized vector supplied in our TA Cloning kits have single, overhanging 3´ deoxythymidine (T) residues. This allows PCR inserts to ligate efficiently with the vector.
Assuming that the primer is at a 50 nM final concentration and 50 mM final salt concentration, the melting temperatures are: M13 Forward (-20) Primer = 52.7 and the M13 Reverse Primer = 45.3. For use in the control PCR reaction we recommend using an annealing temperature of 56C.
CIP will remove the 5' phosphates from DNA or RNA, acting on both protruding or recessed phosphates. In the GeneRacer kit, it is used to eliminate any background RNA, including non-mRNA or truncated mRNA that does not have the 5' Methyl Cap structure. CIP will not digest the Methyl Cap structure, allowing these capped transcripts to be further processed in the GeneRacer protocol and only allowing full length transcripts to be amplified by 5' RACE.