T7 Promoter Primer

Catalog number: N56002

Invitrogen™  Related applications: Sanger Sequencing

Error loading your content!

  Catalog number
Select a plan
Unit size
Price ({{currency}}) Availability Qty
{{product.sku}} {{product.sku}} also known as {{product.formattedSku}} 
Pro add-ons

Your on-site stock

›› {{supplyCenter.scName}}({{scProduct.stockOnHand}} In stock)
›› {{supplyCenter.scName}}(Out of stock)
›› {{supplyCenter.scName}}
This item is not currently available on-site. Depending on your Supply Center settings you may be able to add the item to cart above else use the Order Non-Stocked Items' tab on the Supply Center home page.
Back to top


Invitrogen offers primers for PCR amplification that complement many of the vectors currently available. All primers are:

• Desalted and purified by gel filtration
• Assayed for function by PCR amplification
• Provided in 2 µg quantity

For Research Use Only. Not for use in diagnostic procedures.


Form: Lyophilized
Mass: 2 µg
Primer Length: 20 -mer
Primer Sequence: 5´d[TAATACGACTCACTATAGGG]3´
Primer Type: T7 Primers
Product Size: 2 µg
Purification: Gel-Purified
Quantity: 327 picomole
Shipping Condition: Room Temperature

Contents & storage

Primer are supplied lyophilized in 10 mM Tris-HCl, pH 7.5, 1 mM EDTA. Store at -20°C. Guaranteed stable for 6 months when properly stored.


Manuals & protocols

Recommended products