M13/pUC Sequencing Primer (-46), 22-mer
M13/pUC Sequencing Primer (-46), 22-mer
Thermo Scientific™

M13/pUC Sequencing Primer (-46), 22-mer

Thermo Scientific M13/pUC Sequencing Primer (-46), 22-mer is a synthetic single-stranded 22-mer oligonucleotide with free 5'- and 3'-hydroxyl ends. ThisRead more
Have Questions?
Catalog number SO114
Price (USD)/ 10 µM
95.00
-
Add to cart
Price (USD)/ 10 µM
95.00
Add to cart
M13/pUC Sequencing Primer (-46), 22-mer
Catalog numberSO114
Price (USD)/ 10 µM
95.00
-
Add to cart

Thermo Scientific M13/pUC Sequencing Primer (-46), 22-mer is a synthetic single-stranded 22-mer oligonucleotide with free 5'- and 3'-hydroxyl ends. This M13/pUC primer anneals to the region in the 5'-terminus of the lacZ gene. All primers are supplied as 10 μM aqueous solutions.

Applications
• Sequencing of DNA fragments inserted into the MCS within the lacZ gene of various cloning vectors, such as pUC19, pTZ19R, pTZ57R, M13mp18, and pBluescript II
• Colony screening by PCR

Primer Sequence: 5'-d(GCCAGGGTTTTCCCAGTCACGA)-3'

For Research Use Only. Not for use in diagnostic procedures.
Specifications
Product TypeSequencing Primer
Shipping ConditionDry Ice
Concentration10 μM
PrimerM13
Quantity10 μM, 45 μL
VectorpUC19, pTZ19R, pTZ57R, M13mp18, pBluescript II
For Use With (Application)Sequencing
FormLiquid
Unit Size10 µM
Contents & Storage
M13/pUC Sequencing Primer (-46), 22-mer, 10 μM (45 μL)

Store at –20°C.