Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
Thermo Scientific M13/pUC Reverse Sequencing Primer (-46), 24-mer is a synthetic single-stranded 24-mer oligonucleotide with free 5'- and 3'-hydroxyl ends. This M13/pUC primer anneals to the region in the 5'-terminus of the lacZ gene. All primers are supplied as 10 μM aqueous solutions.
Applications
• Sequencing of DNA fragments inserted into the MCS within the lacZ gene of various cloning vectors, such as pUC19, pTZ19R, pTZ57R, M13mp18, and pBluescript II
• Colony screening by PCR
Primer Sequence: 5'-d(GAGCGGATAACAATTTCACACAGG)-3'