SP6 promoter Sequencing Primer, 24-mer
SP6 promoter Sequencing Primer, 24-mer
Thermo Scientific™

SP6 promoter Sequencing Primer, 24-mer

Thermo Scientific Transcription Promoter Sequencing Primers are single-stranded oligonucleotides with 5'- and 3'-hydroxyl ends. This SP6 Promoter Sequencing Primer, 24-merRead more
Have Questions?
Catalog number SO117
Price (USD)/ 10 µM
101.00
-
Add to cart
Price (USD)/ 10 µM
101.00
Add to cart
SP6 promoter Sequencing Primer, 24-mer
Catalog numberSO117
Price (USD)/ 10 µM
101.00
-
Add to cart

Thermo Scientific Transcription Promoter Sequencing Primers are single-stranded oligonucleotides with 5'- and 3'-hydroxyl ends. This SP6 Promoter Sequencing Primer, 24-mer is complementary to the SP6 RNA Polymerase promoter region and is supplied as 10 μM aqueous solutions.

Applications
• Sequencing of DNA fragments located downstream from the SP6 RNA polymerase promoter sequence in common cloning vectors, such as pTZ19R, pTZ57R, and pBluescript II

Promoter Sequence: 5'-d (CATACGATTTAGGTGACACTATAG)-3'

Related products
SP6 promoter Sequencing Primer, 18-mer
T7 promoter Sequencing Primer, 20-mer
T3 promoter Sequencing Primer, 17-mer
T3 promoter Sequencing Primer, 24-mer

Notes
• Primers cannot be used for certain plasmids that contain truncated, but still fully functional promoters
• Primers are not phosphorylated

For Research Use Only. Not for use in diagnostic procedures.
Specifications
PromoterSP6, T3, T7
Product TypeSequencing Primer
Shipping ConditionDry Ice
Concentration10 μM
PrimerSP6
Quantity10 μM, 42 μL
VectorpTZ19R, pTZ57R, pBluescript II
For Use With (Application)Sequencing
FormLiquid
Unit Size10 µM
Contents & Storage
SP6 promoter Sequencing Primer, 24-mer, 10 μM (42 μL)

Store at –20°C.