Thermo Scientific Transcription Promoter Sequencing Primers are single-stranded oligonucleotides with 5'- and 3'-hydroxyl ends. The primers are complementary to the SP6 RNA Polymerase promoter region and are supplied as 10 µM aqueous solutions.

Applications

• Sequencing of DNA fragments located downstream from the SP6 RNA polymerase promoter sequence in common cloning vectors, such as pTZ19R, pTZ57R, and pBluescript II

Quality Control
• Functionally tested by dideoxy sequencing of a vector containing an appropriate RNA polymerase promoter sequence.

Catalog and Promoter sequences:
• SO116—SP6 promoter sequencing primer, 18-mer 5'-d (ATTTAGGTGACACTATAG)-3'
• SO117—SP6 promoter sequencing primer, 24-mer 5'-d (CATACGATTTAGGTGACACTATAG)-3'
Note
• Primers cannot be used for certain plasmids that contain truncated, but still fully functional promoters. Primers are not phosphorylated.

Related Products
SP6 promoter Sequencing Primer, 18-mer
T7 promoter Sequencing Primer, 20-mer
T3 promoter Sequencing Primer, 17-mer
T3 promoter Sequencing Primer, 24-mer