This product is only available through your local Thermo Scientific supplier. Learn where to buy >

SP6 promoter Sequencing Primer, 24-mer

Catalog number: SO117

Thermo Scientific™  Related applications: DNA Sequencing

Error loading your content!

  Catalog number
Select a plan
Unit size
Price ({{currency}}) Availability Qty
{{product.sku}} {{product.sku}} also known as {{product.formattedSku}} 
Pro add-ons

Your on-site stock

›› {{supplyCenter.scName}}({{scProduct.stockOnHand}} In stock)
›› {{supplyCenter.scName}}(Out of stock)
›› {{supplyCenter.scName}}
This item is not currently available on-site. Depending on your Supply Center settings you may be able to add the item to cart above else use the Order Non-Stocked Items' tab on the Supply Center home page.
Back to top


Thermo Scientific Transcription Promoter Sequencing Primers are single-stranded oligonucleotides with 5'- and 3'-hydroxyl ends. The primers are complementary to the SP6 RNA Polymerase promoter region and are supplied as 10 µM aqueous solutions.


• Sequencing of DNA fragments located downstream from the SP6 RNA polymerase promoter sequence in common cloning vectors, such as pTZ19R, pTZ57R, and pBluescript II

Quality Control
• Functionally tested by dideoxy sequencing of a vector containing an appropriate RNA polymerase promoter sequence.

Catalog and Promoter sequences:
• SO116—SP6 promoter sequencing primer, 18-mer 5'-d (ATTTAGGTGACACTATAG)-3'
• SO117—SP6 promoter sequencing primer, 24-mer 5'-d (CATACGATTTAGGTGACACTATAG)-3'
• Primers cannot be used for certain plasmids that contain truncated, but still fully functional promoters. Primers are not phosphorylated.

Related Products
SP6 promoter Sequencing Primer, 18-mer
T7 promoter Sequencing Primer, 20-mer
T3 promoter Sequencing Primer, 17-mer
T3 promoter Sequencing Primer, 24-mer
For Research Use Only. Not for use in diagnostic procedures.


Primer Type: SP6 Primers
Product Size: 10 µM


Manuals & protocols

Recommended products