T3 promoter Sequencing Primer, 24-mer
T3 promoter Sequencing Primer, 24-mer
Thermo Scientific™

T3 promoter Sequencing Primer, 24-mer

Thermo Scientific Transcription Promoter Sequencing Primers are single-stranded oligonucleotides with 5'- and 3'-hydroxyl ends. The primers are complementary to theRead more
Have Questions?
Catalog number SO120
Price (USD)/ 10 µM
101.00
-
Add to cart
Price (USD)/ 10 µM
101.00
Add to cart
T3 promoter Sequencing Primer, 24-mer
Catalog numberSO120
Price (USD)/ 10 µM
101.00
-
Add to cart

Thermo Scientific Transcription Promoter Sequencing Primers are single-stranded oligonucleotides with 5'- and 3'-hydroxyl ends. The primers are complementary to the T3 RNA Polymerase promoter region and are supplied as 10 µM aqueous solutions.

Applications
• Sequencing of DNA fragments located downstream from the T3 RNA polymerase promoter sequence in common cloning vectors, such as pTZ19R, pTZ57R, and pBluescript II

Promoter Sequence 5'-d (GCGCGAAATTAACCCTCACTAAAG)-3'

Related products
SP6 promoter Sequencing Primer, 18-mer
T3 promoter Sequencing Primer, 17-mer
SP6 promoter Sequencing Primer, 24-mer
T7 promoter Sequencing Primer, 20-mer

Notes
• Primers cannot be used for certain plasmids that contain truncated, but still fully functional promoters
• Primers are not phosphorylated

For Research Use Only. Not for use in diagnostic procedures.
Specifications
PromoterSP6, T3, T7
Product TypeSequencing Primer
Shipping ConditionDry Ice
Concentration10 μM
PrimerT3
Quantity10 μM, 42 μL
For Use With (Application)Sequencing
FormLiquid
Unit Size10 µM
Contents & Storage
T3 promoter Sequencing Primer, 24-mer, 10 μM (42 μL)

Store at –20°C.