pJET1.2 Forward Sequencing Primer, 23-mer
This product is being discontinued effective 30 September 2025. Please contact your local sales reptesentative or our customer care teams for additional assistance.
pJET1.2 Forward Sequencing Primer, 23-mer
Thermo Scientific™

pJET1.2 Forward Sequencing Primer, 23-mer

Thermo Scientific sequencing primers are single-stranded oligonucleotides with 5'-hydroxyl and 3'-hydroxyl ends. pJET1.2 sequencing primers flank the Eco32I site inRead more
Have Questions?
Catalog NumberQuantity
SO50110 μM
Catalog number SO501
Price (USD)/ 10 µM
63.25
Add to cart
Quantity:
10 μM
Price (USD)/ 10 µM
63.25
Add to cart

Thermo Scientific sequencing primers are single-stranded oligonucleotides with 5'-hydroxyl and 3'-hydroxyl ends. pJET1.2 sequencing primers flank the Eco32I site in the eco47IR gene of positive selection cloning vector pJET1.2. All primers are supplied as 10 µM aqueous solutions.

Applications
• Sequencing of DNA fragments inserted into Eco32I site within the eco47IR gene of pJET1.2p sequence
• Colony screening by PCR

pJET1.2 Primer sequences
• pJET1.2 forward sequencing primer, 23-mer: 5'-d(CGACTCACTATAGGGAGAGCGGC)-3'
• pJET1.2 reverse sequencing primer, 24-mer: 5'-d(AAGAACATCGATTTTCCATGGCAG)-3'

Related products
pJET1.2 Reverse Sequencing Primer, 24-mer

For Research Use Only. Not for use in diagnostic procedures.
Specifications
For Use With (Application)Sequencing
FormLiquid
Product TypeForward Sequencing Primer
Quantity10 μM
Shipping ConditionDry Ice
VectorpJET1.2
Concentration10 μM
PrimerpJET
Unit Size10 µM
Contents & Storage
T3 promoter Sequencing Primer, 24-mer, 10 μM

Store at –20°C.