pJET1.2 Reverse Sequencing Primer, 24-mer
pJET1.2 Reverse Sequencing Primer, 24-mer
Thermo Scientific™

pJET1.2 Reverse Sequencing Primer, 24-mer

Thermo Scientific sequencing primers are single-stranded oligonucleotides with 5'-hydroxyl and 3'-hydroxyl ends. pJET1.2 sequencing primers flank the Eco32I site inRead more
Have Questions?
Catalog number SO511
Price (USD)/ 10 µM
59.00
-
Add to cart
Price (USD)/ 10 µM
59.00
Add to cart
pJET1.2 Reverse Sequencing Primer, 24-mer
Catalog numberSO511
Price (USD)/ 10 µM
59.00
-
Add to cart

Thermo Scientific sequencing primers are single-stranded oligonucleotides with 5'-hydroxyl and 3'-hydroxyl ends. pJET1.2 sequencing primers flank the Eco32I site in the eco47IR gene of positive selection cloning vector pJET1.2. All primers are supplied as 10 µM aqueous solutions.

Applications
• Sequencing of DNA fragments inserted into Eco32I site within the eco47IR gene of pJET1.2p sequence
• Colony screening by PCR

pJET1.2 Primer sequences
• pJET1.2 forward sequencing primer, 23-mer: 5'-d(CGACTCACTATAGGGAGAGCGGC)-3'
• pJET1.2 reverse sequencing primer, 24-mer: 5'-d(AAGAACATCGATTTTCCATGGCAG)-3'

Related products
pJET1.2 Forward Sequencing Primer, 23-mer

For Research Use Only. Not for use in diagnostic procedures.
Specifications
Product TypeForward Sequencing Primer
Shipping ConditionDry Ice
Concentration10 μM
PrimerpJET
Quantity10 μM, 84 μL
VectorpJET1.2
For Use With (Application)Sequencing
FormLiquid
Unit Size10 µM
Contents & Storage
pJET1.2 Forward Sequencing Primer, 23-mer, 10 μM (84 μL)

Store at –20°C.