Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
Thermo Scientific Transcription Promoter Sequencing Primers are single-stranded oligonucleotides with 5'- and 3'-hydroxyl ends. The primers are complementary to the T3 RNA Polymerase promoter region and are supplied as 10 µM aqueous solutions.
Applications
• Sequencing of DNA fragments located downstream from the T3 RNA polymerase promoter sequence in common cloning vectors, such as pTZ19R, pTZ57R, and pBluescript II
Promoter Sequence 5'-d (GCGCGAAATTAACCCTCACTAAAG)-3'
Related products
SP6 promoter Sequencing Primer, 18-mer
T3 promoter Sequencing Primer, 17-mer
SP6 promoter Sequencing Primer, 24-mer
T7 promoter Sequencing Primer, 20-mer
Notes
• Primers cannot be used for certain plasmids that contain truncated, but still fully functional promoters
• Primers are not phosphorylated