T7 RNA Polymerase, HC (200 U/μL)
T7 RNA Polymerase, HC (200 U/μL)
Thermo Scientific™

T7 RNA Polymerase, HC (200 U/μL)

Thermo Scientific Bacteriophage T7 RNA polymerase is a DNA-dependent RNA polymerase with strict specificity for its respective double-stranded promoters. It자세히 알아보기
Have Questions?
카탈로그 번호수량
EP011325,000 units
카탈로그 번호 EP0113
제품 가격(KRW)
381,000
온라인 행사
Ends: 31-Mar-2026
435,000
할인액 54,000 (12%)
Each
카트에 추가하기
수량:
25,000 units
대량 주문 또는 맞춤형 요청
제품 가격(KRW)
381,000
온라인 행사
Ends: 31-Mar-2026
435,000
할인액 54,000 (12%)
Each
카트에 추가하기
Thermo Scientific Bacteriophage T7 RNA polymerase is a DNA-dependent RNA polymerase with strict specificity for its respective double-stranded promoters. It catalyzes the 5'→3' synthesis of RNA on either single-stranded DNA or double-stranded DNA downstream from it promoter.

Highlights

• Incorporates modified nucleotides (e.g., aminoallyl-, biotin-, fluorescein-, digoxigenin-labeled nucleotides)

Applications

Synthesis of unlabeled and labeled RNA that can be used:

• For hybridization, in vitro RNA translation
• As aRNA, siRNA, substrate in RNase protection assays, template for genomic DNA sequencing
• In studies of RNA secondary structure and RNA-protein interactions, RNA splicing

Consensus promoter sequence:
T7: TAATACGACTCACTATAGGGAGA
For Research Use Only. Not for use in diagnostic procedures.
사양
농도>200U/µL
수량25,000 units
중합효소T7 RNA Polymerase
Unit SizeEach

자주 묻는 질문(FAQ)

What is the advantage of using TranscriptAid T7 High Yield Transcription Kit over Thermo Scientific T7 RNA Polymerase with a standard transcription buffer?

TranscriptAid T7 High Yield Transcription Kit is designed to produce both long and short transcripts for applications that require large yields of RNA (milligram amounts). The kit can achieve 10 times greater amount than from conventional in vitro transcription reactions with T7 RNA polymerase due to its unique proprietary enzyme and buffer formulations. Please note that TranscriptAid T7 High Yield Transcription Kit is not recommended for generation of radioactively labelled RNA. Due to large quantities of RNA synthesized with the kit, generation of high specific activity radiolabeled probes would require prohibitively large amounts of radiolabeled nucleotide.