TheraPure™ GMP T7 RNA Polymerase, 200 U/μL
TheraPure™ GMP T7 RNA Polymerase, 200 U/μL
TheraPure™ GMP T7 RNA Polymerase, 200 U/μL
Thermo Scientific™

TheraPure™ GMP T7 RNA Polymerase, 200 U/μL

Thermo Scientific TheraPure GMP* T7 RNA Polymerase is manufactured to ICH Q7 GMP principles and supported by comprehensive documentation package.Más información
Have Questions?
Cambiar vistabuttonViewtableView
Número de catálogoCantidad
EP011SKB0112000 kU
EP011SKB008200 kU
EP011SKB0031000 kU
EP011SKB0045000 kU
EP011SKB00640 000 kU
Número de catálogo EP011SKB011
Precio (MXN)
-
Cantidad:
2000 kU

Thermo Scientific TheraPure GMP* T7 RNA Polymerase is manufactured to ICH Q7 GMP principles and supported by comprehensive documentation package. It is designed for synthesis of mRNA in the development and manufacturing of mRNA therapeutics and vaccines. As an DNA-dependent RNA polymerase, it synthesizes RNA 5'→3' from linear DNA containing the T7 promoter (TAATACGACTCACTATAGGGAGA).

Designed for process development and manufacturing
TheraPure GMP T7 RNA Polymerase helps accelerate mRNA vaccine and therapeutics production from preclinical development to commercialization by providing:
Quality—meet critical product quality needs to help accelerate therapeutic development and manufacturing
Minimal risk—help reduce risks in developing therapeutics by utilizing proven products
Technical partnership—partner with expert product and technical support
Secure and consistent supply—count on a secure and stable supply of product at a global scale

Comprehensive quality system
TheraPure GMP T7 RNA Polymerase is supported by a extensive quality system and documentation including:
• Manufactured to relevant ICH Q7 GMP guidelines
• Animal-origin free (AOF) manufacturing processes, materials, and facilities
• Validated manufacturing processes and analytical test methods
• Comprehensive impurity profiles
• Verified compendial assays where applicable
• Product stability data
• Tested by analytical methods following ICH Q2 guidelines whenever possible
• Drug master file (DMF)

Enzyme activity
One unit of enzyme incorporates 1 nmol of AMP into a polynucleotide fraction in 60 minutes at 37°C.

For additional TheraPure GMP products or customization, please visit www.thermofisher.com/therapure.

*TheraPure GMP refers to the quality level of the raw, ancillary, or starting materials to be used for further manufacturing. TheraPure GMP products are manufactured in facilities with ISO 9001–certified quality management systems that operate in accordance with relevant good manufacturing practice (GMP) principles, as outlined in ICH Q7 or equivalent guidance documents or standards.

For Research Use or Further Manufacturing. Not for diagnostic use or direct administration into humans or animals.
Especificaciones
AspectoTransparent
Concentración200 U/μl
Sistema de expresiónE. coli
Tipo de producto finalLiquid
Para utilizar con (aplicación)IVT Transcription, RNA synthesis, mRNA synthesis
Masa99 kDa
Porcentaje de pureza≥95
Cantidad2000 kU
FuenteBacteriophage T7
Tampón de almacenamiento25 mM HEPES-NaOH, pH 7.6, 0.1 mM EDTA-Na2, 150 mM NaCl, 10 mM DTT, 0.09% Triton X-100, 50% glycerol
PolimerasaARN-polimerasa T7
Línea de productosTheraPure™ GMP
PromotorT7
Intervalo de pH7.2 to 8.0
Unit SizeEach
Contenido y almacenamiento
Store at -20 ± 5°C.