T7 RNA Polymerase, HC (200 U/μL)
T7 RNA Polymerase, HC (200 U/μL)
Thermo Scientific™

T7 RNA Polymerase, HC (200 U/μL)

Thermo Scientific Bacteriophage T7 RNA polymerase is a DNA-dependent RNA polymerase with strict specificity for its respective double-stranded promoters. ItRead more
Have Questions?
Catalog NumberQuantity
EP011325,000 units
Catalog number EP0113
Price (TWD)
11,900.00
Online offer
Ends: 31-Mar-2026
17,000.00
Save 5,100.00 (30%)
Each
Add to cart
Quantity:
25,000 units
Request bulk or custom format
Price (TWD)
11,900.00
Online offer
Ends: 31-Mar-2026
17,000.00
Save 5,100.00 (30%)
Each
Add to cart
Thermo Scientific Bacteriophage T7 RNA polymerase is a DNA-dependent RNA polymerase with strict specificity for its respective double-stranded promoters. It catalyzes the 5'→3' synthesis of RNA on either single-stranded DNA or double-stranded DNA downstream from it promoter.

Highlights

• Incorporates modified nucleotides (e.g., aminoallyl-, biotin-, fluorescein-, digoxigenin-labeled nucleotides)

Applications

Synthesis of unlabeled and labeled RNA that can be used:

• For hybridization, in vitro RNA translation
• As aRNA, siRNA, substrate in RNase protection assays, template for genomic DNA sequencing
• In studies of RNA secondary structure and RNA-protein interactions, RNA splicing

Consensus promoter sequence:
T7: TAATACGACTCACTATAGGGAGA
For Research Use Only. Not for use in diagnostic procedures.
Specifications
Concentration>200U/µL
Quantity25,000 units
PolymeraseT7 RNA Polymerase
Unit SizeEach

Frequently asked questions (FAQs)

What is the advantage of using TranscriptAid T7 High Yield Transcription Kit over Thermo Scientific T7 RNA Polymerase with a standard transcription buffer?

TranscriptAid T7 High Yield Transcription Kit is designed to produce both long and short transcripts for applications that require large yields of RNA (milligram amounts). The kit can achieve 10 times greater amount than from conventional in vitro transcription reactions with T7 RNA polymerase due to its unique proprietary enzyme and buffer formulations. Please note that TranscriptAid T7 High Yield Transcription Kit is not recommended for generation of radioactively labelled RNA. Due to large quantities of RNA synthesized with the kit, generation of high specific activity radiolabeled probes would require prohibitively large amounts of radiolabeled nucleotide.