gRNA Design Details

Target DNA Sequence
AGTGCGATCGATTCAGCCCG
PAM Sequence
AGG
Target locus
Chr.11: 106077818 - 106077840 on GRCh38
Strand
Forward
Application
Gene Knockout
Score: 90.29/100

Rank:
scoring gRNA

Targeted Gene

Gene Symbol
AASDHPPT
Entrez Gene ID
60496
Gene Name
aminoadipate-semialdehyde dehydrogenase-phosphopantetheinyl transferase
Gene Aliases
AASD-PPT, ACPS, CGI-80, LYS2, LYS5
Chromosome Location
Chr.11: 106077565 - 106098692 on GRCh38
UniGene ID
Hs.524009
Species
Human

Targeted Isoforms Translated Protein Targeted Exon(s)
RefSeq NM_015423.2 NP_056238.2 1