gRNA Design Details

Target DNA Sequence
GTCTATCCAGCCGGAGGAGA
PAM Sequence
AGG
Target locus
Chr.9: 4309301 - 4309323 on GRCm38
Strand
Reverse
Application
Gene Knockout
Score: 85.42/100

Rank:
scoring gRNA

Targeted Gene

Gene Symbol
Aasdhppt
Entrez Gene ID
67618
Gene Name
aminoadipate-semialdehyde dehydrogenase-phosphopantetheinyl transferase
Gene Aliases
2010309J24Rik, 2810407B07Rik, AASD-PPT, CGI-80, LYS2, LYS5
Chromosome Location
Chr.9: 4294793 - 4309509 on GRCm38
UniGene ID
Mm.33970
Species
Mouse

Targeted Isoforms Translated Protein Targeted Exon(s)
RefSeq NM_026276.3 NP_080552.3 1