gRNA Design Details

Target DNA Sequence
GTCGGAACCTGAGTTGAAAC
PAM Sequence
TGG
Target locus
Chr.8: 122576808 - 122576830 on GRCm38
Strand
Reverse
Application
Gene Knockout
Score: 86.47/100

Rank:
scoring gRNA

Targeted Gene

Gene Symbol
Aprt
Entrez Gene ID
11821
Gene Name
adenine phosphoribosyl transferase
Gene Aliases
C85684
Chromosome Location
Chr.8: 122574637 - 122576907 on GRCm38
UniGene ID
Mm.1786
Species
Mouse

Targeted Isoforms Translated Protein Targeted Exon(s)
RefSeq NM_009698.2 NP_033828.2 1