gRNA Design Details

Target DNA Sequence
GGATCATAGGTCGAAGTGCG
PAM Sequence
TGG
Target locus
Chr.9: 133262133 - 133262155 on GRCh38
Strand
Forward
Application
Gene Knockout
Score: 92.46/100

Rank:
scoring gRNA

Targeted Gene

Gene Symbol
ABO
Entrez Gene ID
28
Gene Name
ABO blood group (transferase A, alpha 1-3-N-acetylgalactosaminyltransferase; transferase B, alpha 1-3-galactosyltransferase)
Gene Aliases
A3GALNT, A3GALT1, GTB, NAGAT
Chromosome Location
Chr.9: 133255176 - 133275214 on GRCh38
UniGene ID
Hs.654423
Species
Human

Targeted Isoforms Translated Protein Targeted Exon(s)
RefSeq NM_020469.2 NP_065202.2 2