gRNA Design Details

Target DNA Sequence
GAAGGTCCCCTCCCAGATGA
PAM Sequence
TGG
Target locus
Chr.2: 26846030 - 26846052 on GRCm38
Strand
Forward
Application
Gene Knockout
Score: 84.85/100

Rank:
scoring gRNA

Targeted Gene

Gene Symbol
Abo
Entrez Gene ID
80908
Gene Name
ABO blood group (transferase A, alpha 1-3-N-acetylgalactosaminyltransferase, transferase B, alpha 1-3-galactosyltransferase)
Gene Aliases
NAGAT
Chromosome Location
Chr.2: 26842496 - 26864995 on GRCm38
UniGene ID
Mm.160386
Species
Mouse

Targeted Isoforms Translated Protein Targeted Exon(s)
RefSeq NM_030718.5 NP_109643.3 5