gRNA Design Details

Target DNA Sequence
TGCGGCCCACTTTAATCGCT
PAM Sequence
GGG
Target locus
Chr.6: 42246593 - 42246615 on GRCm38
Strand
Forward
Application
Gene Knockout
Score: 91.25/100

Rank:
scoring gRNA

Targeted Gene

Gene Symbol
Gstk1
Entrez Gene ID
76263
Gene Name
glutathione S-transferase kappa 1
Gene Aliases
0610025I19Rik, AW260476, DsbA-L
Chromosome Location
Chr.6: 42245935 - 42250441 on GRCm38
UniGene ID
Mm.267014
Species
Mouse

Targeted Isoforms Translated Protein Targeted Exon(s)
RefSeq NM_029555.2 NP_083831.1 2