gRNA Design Details

Target DNA Sequence
CATGGACACTCGAATTCAGA
PAM Sequence
TGG
Target locus
Chr.3: 107942159 - 107942181 on GRCm38
Strand
Reverse
Application
Gene Knockout
Score: 83.79/100

Rank:
scoring gRNA

Targeted Gene

Gene Symbol
Gstm6
Entrez Gene ID
14867
Gene Name
glutathione S-transferase, mu 6
Gene Aliases
-
Chromosome Location
Chr.3: 107938847 - 107953491 on GRCm38
UniGene ID
Mm.458154
Species
Mouse

Targeted Isoforms Translated Protein Targeted Exon(s)
RefSeq NM_008184.3 NP_032210.3 5