gRNA Design Details

Target DNA Sequence
CACGTCATAGAAGAGCTCCA
PAM Sequence
CGG
Target locus
Chr.7: 143263533 - 143263555 on GRCh38
Strand
Reverse
Application
Gene Knockout
Score: 89.44/100

Rank:
scoring gRNA

Targeted Gene

Gene Symbol
GSTK1
Entrez Gene ID
373156
Gene Name
glutathione S-transferase kappa 1
Gene Aliases
GST, GST 13-13, GST13, GST13-13, GSTK1-1, hGSTK1
Chromosome Location
Chr.7: 143263429 - 143269129 on GRCh38
UniGene ID
Hs.390667
Species
Human

Targeted Isoforms Translated Protein Targeted Exon(s)
RefSeq NM_001143679.1 NP_001137151.1 1
NM_001143680.1 NP_001137152.1 1
NM_001143681.1 NP_001137153.1 1
NM_015917.2 NP_057001.1 1