Product Details

SNP ID: rs148076461
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.12:50086781 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: ATTCGTGAACTGGTACCAGAATCCC[A/C]GGCCTATATGGATCTCTTGGCTTTT
Phenotype: MIM: 602866 MIM: 601735
Polymorphism: A/C, Transversion substitution
Allele Nomenclature
Literature Links: ASIC1 PubMed Links

Gene Details

Gene: ASIC1
Gene Name: acid sensing ion channel subunit 1

There are no transcripts associated with this gene.

Gene: SMARCD1
Gene Name: SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_003076.4	604	Missense Mutation	CAG,CCG	Q145P	NP_003067.3
NM_139071.2	604	Missense Mutation	CAG,CCG	Q145P	NP_620710.2
XM_005269107.3	604	Missense Mutation	CAG,CCG	Q145P	XP_005269164.2
XM_011538695.1	604	Missense Mutation	CAG,CCG	Q145P	XP_011536997.1

View Full Product Details