Product Details

SNP ID: rs149159438
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.7:99460096 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CCACAAGGCTCTGACCTCTTTGAAA[C/T]GCTCCGAAAATGCCACTAGGACTGA
Phenotype: MIM: 603052
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: ATP5J2 PubMed Links

Gene Details

Gene: ATP5J2
Gene Name: ATP synthase, H+ transporting, mitochondrial Fo complex subunit F2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001003713.2	189	Silent Mutation			NP_001003713.1
NM_001003714.2	189	Silent Mutation			NP_001003714.1
NM_001039178.2	189	Silent Mutation			NP_001034267.1
NM_004889.3	189	Silent Mutation			NP_004880.1

Gene: ATP5J2-PTCD1
Gene Name: ATP5J2-PTCD1 readthrough

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001198879.1	189	Silent Mutation			NP_001185808.1

Gene: CPSF4
Gene Name: cleavage and polyadenylation specific factor 4

There are no transcripts associated with this gene.

View Full Product Details