Product Details

SNP ID: rs1131872
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.11:6611971 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CCCGGCCCTCACCCGCCCCACGCCG[T/C]TCAGCTGGCTCCCCGGCCCGCGCCG
Phenotype: MIM: 603057 MIM: 602366 MIM: 615818 MIM: 600475 MIM: 607998
Polymorphism: T/C, Transition substitution
Allele Nomenclature
Literature Links: DCHS1 PubMed Links

Gene Details

Gene: DCHS1
Gene Name: dachsous cadherin-related 1

There are no transcripts associated with this gene.

Gene: ILK
Gene Name: integrin linked kinase

There are no transcripts associated with this gene.

Gene: RRP8
Gene Name: ribosomal RNA processing 8, methyltransferase, homolog (yeast)

There are no transcripts associated with this gene.

Gene: TAF10
Gene Name: TATA-box binding protein associated factor 10

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_006284.3	274	Silent Mutation	GAA,GAG	E73E	NP_006275.1

Gene: TPP1
Gene Name: tripeptidyl peptidase 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_000391.3	274	Intron			NP_000382.3

View Full Product Details