Product Details

SNP ID: rs180768366
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.16:28844302 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TCGTCTCCCTTCTTTAAAATGCCAC[A/G]CTCTAGTGTACCTGTCACCACGGTG
Phenotype: MIM: 607931 MIM: 608937 MIM: 602389
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: ATXN2L PubMed Links

Gene Details

Gene: ATXN2L
Gene Name: ataxin 2 like

There are no transcripts associated with this gene.

Gene: MIR4721
Gene Name: microRNA 4721

There are no transcripts associated with this gene.

Gene: SH2B1
Gene Name: SH2B adaptor protein 1

There are no transcripts associated with this gene.

Gene: TUFM
Gene Name: Tu translation elongation factor, mitochondrial

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_003321.4	1246	Missense Mutation	CGT,TGT	R284C	NP_003312.3
XM_011545928.2	1246	Intron			XP_011544230.1
XM_017023619.1	1246	Missense Mutation	CGT,TGT	R284C	XP_016879108.1

View Full Product Details