Product Details

SNP ID: rs201706642
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.4:185405781 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: AAAACAGTGTCTGAAACAGCTTACC[C/G]ATCATAACTGGAGTTCCTTCACTTT
Phenotype: MIM: 611482
Polymorphism: C/G, Transversion substitution
Allele Nomenclature
Literature Links: ANKRD37 PubMed Links

Gene Details

Gene: ANKRD37
Gene Name: ankyrin repeat domain 37

There are no transcripts associated with this gene.

Gene: C4orf47
Gene Name: chromosome 4 open reading frame 47

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001114357.1	1314	Intron			NP_001107829.1
XM_005263019.3	1314	Intron			XP_005263076.1
XM_011531989.2	1314	Intron			XP_011530291.1
XM_017008236.1	1314	Intron			XP_016863725.1
XM_017008237.1	1314	Intron			XP_016863726.1
XM_017008238.1	1314	Intron			XP_016863727.1
XM_017008239.1	1314	Intron			XP_016863728.1
XM_017008240.1	1314	Intron			XP_016863729.1
XM_017008241.1	1314	Intron			XP_016863730.1
XM_017008242.1	1314	Intron			XP_016863731.1

Gene: LRP2BP
Gene Name: LRP2 binding protein

There are no transcripts associated with this gene.

Gene: UFSP2
Gene Name: UFM1 specific peptidase 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_018359.3	1314	Silent Mutation	ATC,ATG	I399M	NP_060829.2

View Full Product Details