Product Details

SNP ID: rs1554947
Assay Type: Validated
NCBI dbSNP Submissions: NA
Location: Chr.17:7382947 on Build GRCh38
Set Membership: HapMap Validated
Context Sequence [VIC/FAM]: CAGACATGCTTCCTGAGGCTGGCTC[C/T]CTGTGGCTACTGAAGCTGCTCCGGG
Phenotype: MIM: 607611 MIM: 608076
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: PLSCR3 PubMed Links

Gene Details

Gene: PLSCR3
Gene Name: phospholipid scramblase 3

There are no transcripts associated with this gene.

Gene: TMEM256-PLSCR3
Gene Name: TMEM256-PLSCR3 readthrough (NMD candidate)

There are no transcripts associated with this gene.

Gene: TNK1
Gene Name: tyrosine kinase non receptor 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001251902.1	253	Silent Mutation	TCC,TCT	S7S	NP_001238831.1
NM_003985.4	253	Silent Mutation	TCC,TCT	S7S	NP_003976.2
XM_011524045.2	253	Silent Mutation	TCC,TCT	S7S	XP_011522347.1
XM_011524046.2	253	Silent Mutation	TCC,TCT	S7S	XP_011522348.1
XM_011524047.2	253	Silent Mutation	TCC,TCT	S7S	XP_011522349.1
XM_011524048.1	253	UTR 5			XP_011522350.1

View Full Product Details