Product Details

SNP ID
rs967324
Assay Type
Functionally Tested
NCBI dbSNP Submissions
40
Location
Chr.1:66537886 on Build GRCh38
Set Membership
HapMap
Context Sequence [VIC/FAM]
AACCTACATCCATTTAACCACAAAG[C/T]TCATGTTTTTGACCCTCTAGGAACC
Phenotype
MIM: 611540
Polymorphism
C/T, Transition Substitution
Allele Nomenclature
Literature Links
SGIP1 PubMed Links
Additional Information
For this assay, SNP(s) [rs114657047] are located under a primer sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene
SGIP1
Gene Name
SH3 domain GRB2 like endophilin interacting protein 1
Transcript Accession SNP Location SNP Type Codon Change Amino Acid Change Protein ID
NM_001308203.1 Intron NP_001295132.1
NM_032291.3 Intron NP_115667.2
XM_005271264.3 Intron XP_005271321.1
XM_005271268.3 Intron XP_005271325.1
XM_005271270.4 Intron XP_005271327.1
XM_006710961.2 Intron XP_006711024.1
XM_006710966.2 Intron XP_006711029.1
XM_006710967.2 Intron XP_006711030.1
XM_006710969.2 Intron XP_006711032.1
XM_006710971.2 Intron XP_006711034.1
XM_006710972.2 Intron XP_006711035.1
XM_006710973.2 Intron XP_006711036.1
XM_006710974.2 Intron XP_006711037.1
XM_011542291.1 Intron XP_011540593.1
XM_011542292.1 Intron XP_011540594.1
XM_011542293.1 Intron XP_011540595.1
XM_017002505.1 Intron XP_016857994.1
XM_017002506.1 Intron XP_016857995.1
XM_017002507.1 Intron XP_016857996.1
XM_017002508.1 Intron XP_016857997.1
XM_017002509.1 Intron XP_016857998.1
XM_017002510.1 Intron XP_016857999.1
XM_017002511.1 Intron XP_016858000.1
XM_017002512.1 Intron XP_016858001.1
XM_017002513.1 Intron XP_016858002.1
XM_017002514.1 Intron XP_016858003.1
XM_017002515.1 Intron XP_016858004.1
XM_017002516.1 Intron XP_016858005.1
XM_017002517.1 Intron XP_016858006.1
XM_017002518.1 Intron XP_016858007.1
XM_017002519.1 Intron XP_016858008.1
XM_017002520.1 Intron XP_016858009.1
XM_017002521.1 Intron XP_016858010.1
XM_017002522.1 Intron XP_016858011.1
XM_017002523.1 Intron XP_016858012.1
XM_017002524.1 Intron XP_016858013.1
XM_017002525.1 Intron XP_016858014.1
XM_017002526.1 Intron XP_016858015.1
XM_017002527.1 Intron XP_016858016.1
XM_017002528.1 Intron XP_016858017.1
XM_017002529.1 Intron XP_016858018.1
XM_017002530.1 Intron XP_016858019.1
XM_017002531.1 Intron XP_016858020.1
XM_017002532.1 Intron XP_016858021.1
XM_017002533.1 Intron XP_016858022.1
XM_017002534.1 Intron XP_016858023.1
XM_017002535.1 Intron XP_016858024.1
XM_017002536.1 Intron XP_016858025.1
XM_017002537.1 Intron XP_016858026.1

View Full Product Details