Product Details

SNP ID: rs78755073
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.7:151239065 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GGGCAAAATGCTGGGGCCCGGGACA[C/T]GGCTGAAAGTTCCGTCGTGCTGCTT
Phenotype: MIM: 608037 MIM: 615245 MIM: 601737
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: CHPF2 PubMed Links

Gene Details

Gene: CHPF2
Gene Name: chondroitin polymerizing factor 2

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001284295.1	1580	Intron			NP_001271224.1
NM_019015.2	1580	Intron			NP_061888.1

Gene: MIR671
Gene Name: microRNA 671

There are no transcripts associated with this gene.

Gene: SMARCD3
Gene Name: SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 3

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001003801.1	1580	UTR 3			NP_001003801.1
NM_001003802.1	1580	UTR 3			NP_001003802.1
NM_003078.3	1580	UTR 3			NP_003069.2
XM_011516521.2	1580	UTR 3			XP_011514823.1
XM_017012556.1	1580	UTR 3			XP_016868045.1

View Full Product Details