Product Details

SNP ID: rs77431583
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.8:143726269 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: GGCCTAGCTCGGGGCTGTTGTGGGT[C/T]GGGCCGGGGCTCGGGGCAGGGACCG
Phenotype: MIM: 611927
Polymorphism: C/T, Transition substitution
Allele Nomenclature
Literature Links: FAM83H PubMed Links

Gene Details

Gene: FAM83H
Gene Name: family with sequence similarity 83 member H

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_198488.3	4457	Silent Mutation	CCA,CCG	P1064P	NP_940890.3
XM_005250887.3	4457	Silent Mutation	CCA,CCG	P1083P	XP_005250944.1
XM_005250888.3	4457	Silent Mutation	CCA,CCG	P1070P	XP_005250945.1
XM_005250889.3	4457	Silent Mutation	CCA,CCG	P1064P	XP_005250946.1
XM_011516980.2	4457	Silent Mutation	CCA,CCG	P1265P	XP_011515282.2
XM_011516981.2	4457	Silent Mutation	CCA,CCG	P1120P	XP_011515283.1

Gene: FAM83H-AS1
Gene Name: FAM83H antisense RNA 1 (head to head)

There are no transcripts associated with this gene.

Gene: MAPK15
Gene Name: mitogen-activated protein kinase 15

There are no transcripts associated with this gene.

Gene: MIR4664
Gene Name: microRNA 4664

There are no transcripts associated with this gene.

View Full Product Details