Product Details

SNP ID: rs74462031
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.11:215908 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: CCCTGGCGAGGGTGGGGGGGCGTAG[G/T]GTGGGGACAAGGAGGCCAGATAGAA
Phenotype: MIM: 615417 MIM: 609146 MIM: 604481
Polymorphism: G/T, Transversion substitution
Allele Nomenclature
Literature Links: BET1L PubMed Links

Gene Details

Gene: BET1L
Gene Name: Bet1 golgi vesicular membrane trafficking protein like

There are no transcripts associated with this gene.

Gene: MIR6743
Gene Name: microRNA 6743

There are no transcripts associated with this gene.

Gene: RIC8A
Gene Name: RIC8 guanine nucleotide exchange factor A

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001286134.1	2038	Intron			NP_001273063.1
NM_021932.5	2038	Intron			NP_068751.4
XM_005253052.3	2038	Intron			XP_005253109.1
XM_017018107.1	2038	Intron			XP_016873596.1

Gene: SIRT3
Gene Name: sirtuin 3

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001017524.2	2038	UTR 3			NP_001017524.1
NM_012239.5	2038	UTR 3			NP_036371.1
XM_005252835.1	2038	UTR 3			XP_005252892.1
XM_011519956.1	2038	UTR 3			XP_011518258.1
XM_011519957.1	2038	UTR 3			XP_011518259.1
XM_017017428.1	2038	UTR 3			XP_016872917.1
XM_017017429.1	2038	UTR 3			XP_016872918.1
XM_017017430.1	2038	UTR 3			XP_016872919.1
XM_017017431.1	2038	UTR 3			XP_016872920.1

View Full Product Details