Product Details

SNP ID: rs78946900
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.17:35129352 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: ATGGGCATGGGACGTCCTGACCCCA[A/G]TTGGGAGGGTGAAGGGACAGGAAGG
Phenotype: MIM: 602954
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: FNDC8 PubMed Links

Gene Details

Gene: FNDC8
Gene Name: fibronectin type III domain containing 8

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_017559.2	4601	Intron			NP_060029.1

Gene: NLE1
Gene Name: notchless homolog 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001014445.2	4601	Intron			NP_001014445.1
NM_018096.4	4601	Intron			NP_060566.2
XM_017024777.1	4601	UTR 3			XP_016880266.1

Gene: RAD51D
Gene Name: RAD51 paralog D

There are no transcripts associated with this gene.

Gene: RAD51L3-RFFL
Gene Name: RAD51L3-RFFL readthrough

There are no transcripts associated with this gene.

View Full Product Details