Product Details

SNP ID: rs115678349
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.3:187721823 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TATTTTCTTACTTATACAGATGCAA[A/T]ACTTAAAATATTCTCTTAAGTGCTC
Phenotype: MIM: 109565 MIM: 609138
Polymorphism: A/T, Transversion substitution
Allele Nomenclature
Literature Links: BCL6 PubMed Links

Gene Details

Gene: BCL6
Gene Name: B-cell CLL/lymphoma 6

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001130845.1	3121	UTR 3			NP_001124317.1
NM_001134738.1	3121	UTR 3			NP_001128210.1
NM_001706.4	3121	UTR 3			NP_001697.2
XM_005247694.3	3121	UTR 3			XP_005247751.1
XM_011513062.2	3121	UTR 3			XP_011511364.1

Gene: LOC100131635
Gene Name: hCG1645011-like

There are no transcripts associated with this gene.

Gene: RTP2
Gene Name: receptor transporter protein 2

There are no transcripts associated with this gene.

View Full Product Details