Product Details

SNP ID: rs112445646
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.4:15690165 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: TAACTGCTGTAACCATCCAGAAACG[A/G]CATTGATGTTGCTTCACGTTGCTGA
Phenotype: MIM: 600387 MIM: 605655
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: BST1 PubMed Links

Gene Details

Gene: BST1
Gene Name: bone marrow stromal cell antigen 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_004334.2	4167	Intron			NP_004325.2
XM_005248185.1	4167	Intron			XP_005248242.1
XM_005248186.1	4167	Intron			XP_005248243.1
XM_011513878.2	4167	Intron			XP_011512180.1
XM_011513879.1	4167	Intron			XP_011512181.1
XM_011513881.2	4167	Intron			XP_011512183.1
XM_017008565.1	4167	Intron			XP_016864054.1
XM_017008566.1	4167	Intron			XP_016864055.1
XM_017008567.1	4167	Intron			XP_016864056.1

Gene: FAM200B
Gene Name: family with sequence similarity 200 member B

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001145191.1	4167	UTR 3			NP_001138663.1
XM_017008048.1	4167	UTR 3			XP_016863537.1

Gene: FBXL5
Gene Name: F-box and leucine rich repeat protein 5

There are no transcripts associated with this gene.

View Full Product Details