Product Details

SNP ID: rs116726109
Assay Type: Functionally tested
NCBI dbSNP Submissions: NA
Location: Chr.7:143391066 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]: ATTCCCACCCTCCCCCATGCTGCCA[A/G]GTTGTAGCTATAGCTACAAATAAAA
Phenotype: MIM: 179610 MIM: 602002
Polymorphism: A/G, Transition substitution
Allele Nomenclature
Literature Links: EPHA1 PubMed Links

Gene Details

Gene: EPHA1
Gene Name: EPH receptor A1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_005232.4	3037	Intron			NP_005223.4
XM_006715880.3	3037	UTR 3			XP_006715943.1

Gene: FAM131B
Gene Name: family with sequence similarity 131 member B

There are no transcripts associated with this gene.

Gene: MIR6892
Gene Name: microRNA 6892

There are no transcripts associated with this gene.

Gene: ZYX
Gene Name: zyxin

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001010972.1	3037	UTR 3			NP_001010972.1
NM_003461.4	3037	UTR 3			NP_003452.1
XM_011516569.2	3037	UTR 3			XP_011514871.2
XM_017012587.1	3037	UTR 3			XP_016868076.1

View Full Product Details