Product Details

SNP ID

rs112653404

Assay Type

Functionally Tested

NCBI dbSNP Submissions

NA

Location

Chr.7:87195556 on Build GRCh38

Set Membership

Context Sequence [VIC/FAM]

ATGAGTCTTTTCAACATGGTCTTCA[A/G]CATGGTCTAGAGCTTACCAGTGATC

Phenotype

MIM: 608491 MIM: 616993

Polymorphism

A/G, Transition Substitution

Allele Nomenclature

Literature Links

DMTF1 PubMed Links

Additional Information

For this assay, SNP(s) [rs148183534] are located under a probe sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene

DMTF1

Gene Name

cyclin D binding myb like transcription factor 1

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
NM_001142326.1	4213	UTR 3			NP_001135798.1
NM_001142327.1	4213	UTR 3			NP_001135799.1
NM_021145.3	4213	UTR 3			NP_066968.3
XM_011516735.2	4213	UTR 3			XP_011515037.1
XM_011516737.1	4213	UTR 3			XP_011515039.1
XM_011516739.2	4213	UTR 3			XP_011515041.1
XM_017012865.1	4213	UTR 3			XP_016868354.1
XM_017012866.1	4213	UTR 3			XP_016868355.1
XM_017012867.1	4213	UTR 3			XP_016868356.1
XM_017012868.1	4213	UTR 3			XP_016868357.1
XM_017012869.1	4213	UTR 3			XP_016868358.1
XM_017012870.1	4213	UTR 3			XP_016868359.1
XM_017012871.1	4213	UTR 3			XP_016868360.1
XM_017012872.1	4213	UTR 3			XP_016868361.1
XM_017012873.1	4213	UTR 3			XP_016868362.1
XM_017012874.1	4213	UTR 3			XP_016868363.1
XM_017012875.1	4213	UTR 3			XP_016868364.1
XM_017012876.1	4213	UTR 3			XP_016868365.1
XM_017012877.1	4213	UTR 3			XP_016868366.1
XM_017012878.1	4213	UTR 3			XP_016868367.1

Gene

TMEM243

Gene Name

transmembrane protein 243

Transcript Accession	SNP Location	SNP Type	Codon Change	Amino Acid Change	Protein ID
XM_005250586.3	4213	Intron			XP_005250643.1
XM_005250587.4	4213	Intron			XP_005250644.1
XM_005250588.3	4213	Intron			XP_005250645.1
XM_005250589.3	4213	Intron			XP_005250646.1
XM_017012616.1	4213	Intron			XP_016868105.1
XM_017012617.1	4213	Intron			XP_016868106.1
XM_017012618.1	4213	Intron			XP_016868107.1

View Full Product Details