Product Details

SNP ID
rs117975009
Assay Type
Functionally Tested
NCBI dbSNP Submissions
NA
Location
Chr.19:37337152 on Build GRCh38
Set Membership
Context Sequence [VIC/FAM]
TGAACAACGTCTTTATCATTTGGAC[A/G]TGACCTTCAGAGTATCAGCTGCACT
Phenotype
MIM: 165250
Polymorphism
A/G, Transition Substitution
Allele Nomenclature
Literature Links
HKR1 PubMed Links
Additional Information
For this assay, SNP(s) [rs144190488] are located under a probe sequence. To help evaluate the possible impact of a given SNP on your experiment, please refer to the 1000 Genomes and NCBI dbSNP databases. A higher minor allele frequency in your study population represents a higher risk to assay performance.

Gene Details

Gene
HKR1
Gene Name
HKR1, GLI-Kruppel zinc finger family member
Transcript Accession SNP Location SNP Type Codon Change Amino Acid Change Protein ID
XM_017026672.1 Intron XP_016882161.1
XM_017026673.1 Intron XP_016882162.1
XM_017026674.1 Intron XP_016882163.1
XM_017026675.1 Intron XP_016882164.1
XM_017026676.1 Intron XP_016882165.1
XM_017026677.1 Intron XP_016882166.1
XM_017026678.1 Intron XP_016882167.1
XM_017026679.1 Intron XP_016882168.1
XM_017026680.1 Intron XP_016882169.1
XM_017026681.1 Intron XP_016882170.1
XM_017026682.1 Intron XP_016882171.1
XM_017026683.1 Intron XP_016882172.1
XM_017026684.1 Intron XP_016882173.1
XM_017026685.1 Intron XP_016882174.1
XM_017026686.1 Intron XP_016882175.1
XM_017026687.1 Intron XP_016882176.1
XM_017026688.1 Intron XP_016882177.1
XM_017026689.1 Intron XP_016882178.1
XM_017026690.1 Intron XP_016882179.1
XM_017026691.1 Intron XP_016882180.1
XM_017026692.1 Intron XP_016882181.1
XM_017026693.1 Intron XP_016882182.1
XM_017026694.1 Intron XP_016882183.1
XM_017026695.1 Intron XP_016882184.1
XM_017026696.1 Intron XP_016882185.1
XM_017026697.1 Intron XP_016882186.1
XM_017026698.1 Intron XP_016882187.1
XM_017026699.1 Intron XP_016882188.1
XM_017026700.1 Intron XP_016882189.1
XM_017026701.1 Intron XP_016882190.1
XM_017026702.1 Intron XP_016882191.1
XM_017026703.1 Intron XP_016882192.1
XM_017026704.1 Intron XP_016882193.1
XM_017026705.1 Intron XP_016882194.1
XM_017026706.1 Intron XP_016882195.1
XM_017026707.1 Intron XP_016882196.1
XM_017026708.1 Intron XP_016882197.1
Gene
LOC105372392
Gene Name
uncharacterized LOC105372392
There are no transcripts associated with this gene.

View Full Product Details